Incidental Mutation 'R7389:Trav14d-3-dv8'
ID573325
Institutional Source Beutler Lab
Gene Symbol Trav14d-3-dv8
Ensembl Gene ENSMUSG00000094619
Gene NameT cell receptor alpha variable 14D-3-DV8
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.562) question?
Stock #R7389 (G1)
Quality Score225.009
Status Validated
Chromosome14
Chromosomal Location53078580-53079045 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 53078871 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 63 (Y63H)
Ref Sequence ENSEMBL: ENSMUSP00000100385 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000103608]
Predicted Effect possibly damaging
Transcript: ENSMUST00000103608
AA Change: Y63H

PolyPhen 2 Score 0.905 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000100385
Gene: ENSMUSG00000094619
AA Change: Y63H

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
low complexity region 22 33 N/A INTRINSIC
IGv 45 119 3.4e-15 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 98% (49/50)
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Anxa11 C A 14: 25,872,888 P182Q probably damaging Het
Asns C A 6: 7,689,291 L70F probably damaging Het
Cd163l1 A G 7: 140,228,791 K872E possibly damaging Het
Cntrl A T 2: 35,127,517 K445N probably benign Het
Cyp2c50 G T 19: 40,090,663 R150L probably benign Het
Dqx1 G T 6: 83,064,794 S539I probably null Het
Dusp9 TAAAGCGGAGGCCAAAGCGGAGGCCAAAGCGGAGGCTAAAGCGGAGGCCAAAGCGGAGGCCAAAGCGGAGGCCAAAGCGGAGGCTAAAGCGGAGGCCAAAGCGGAGGCCAAAG TAAAGCGGAGGCCAAAGCGGAGGCCAAAGCGGAGGCTAAAGCGGAGGCCAAAGCGGAGGCCAAAG X: 73,640,611 probably benign Het
Epha3 T C 16: 63,772,984 E247G probably damaging Het
Etl4 C T 2: 20,785,093 Q801* probably null Het
Fabp2 G T 3: 122,895,365 probably benign Het
Fsip2 G A 2: 82,988,796 V4958I possibly damaging Het
Fstl3 G A 10: 79,780,031 C117Y probably damaging Het
Hdgfl2 T G 17: 56,099,389 probably null Het
Igfn1 T C 1: 135,967,047 D1927G probably benign Het
Ino80 A C 2: 119,442,529 S489A probably benign Het
Krt15 A T 11: 100,135,560 V100E possibly damaging Het
Lrriq3 A G 3: 155,188,104 T481A probably benign Het
Map2k3 A T 11: 60,932,036 probably benign Het
Matr3 A G 18: 35,584,585 T617A probably benign Het
Mybpc2 T G 7: 44,505,604 T960P probably benign Het
Ncoa2 T C 1: 13,186,825 N150S possibly damaging Het
Nup153 A T 13: 46,700,987 probably null Het
Obscn A G 11: 59,036,400 L5498P probably benign Het
Olfr111 A G 17: 37,530,657 R227G possibly damaging Het
Olfr1444 G T 19: 12,862,617 V281L probably benign Het
Paqr8 C A 1: 20,935,165 P181Q probably damaging Het
Pcdhgb4 T C 18: 37,722,363 Y604H probably damaging Het
Pja2 T A 17: 64,297,727 E487V probably damaging Het
Pnpla6 C T 8: 3,543,981 R1331* probably null Het
Ppl T A 16: 5,106,713 probably null Het
Rhbdl3 T A 11: 80,346,839 M299K possibly damaging Het
Slc26a9 A G 1: 131,769,248 *791W probably null Het
Slc7a2 A G 8: 40,912,515 Y461C probably benign Het
Sptb G T 12: 76,624,229 Q447K probably damaging Het
Ssh1 A T 5: 113,958,831 I205N probably benign Het
Stab1 C T 14: 31,147,239 V1511I probably benign Het
Tex19.1 T C 11: 121,147,160 W115R possibly damaging Het
Tinf2 G T 14: 55,680,710 probably null Het
Tmeff1 A G 4: 48,617,097 probably null Het
Tnip2 G T 5: 34,513,801 Q33K probably benign Het
Traf3 C A 12: 111,237,753 L59M probably damaging Het
Trim11 C T 11: 58,990,655 S458L probably damaging Het
Tspan18 A T 2: 93,209,927 V161E probably benign Het
Usf3 T A 16: 44,217,941 V928E probably benign Het
Usp29 G A 7: 6,963,458 V767I possibly damaging Het
Usp34 T G 11: 23,345,200 F287L Het
Vmn1r213 T C 13: 23,012,386 C380R probably benign Het
Zfyve9 A G 4: 108,693,318 probably null Het
Other mutations in Trav14d-3-dv8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02839:Trav14d-3-dv8 APN 14 53078790 missense possibly damaging 0.58
R7278:Trav14d-3-dv8 UTSW 14 53078761 missense probably benign
R8009:Trav14d-3-dv8 UTSW 14 53078767 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- ACCTGAGGATATGGGATTAATGTGG -3'
(R):5'- TTGCTGCACAGAAGTAGGTGG -3'

Sequencing Primer
(F):5'- CAGGCAAGTCATGATATCTAAGC -3'
(R):5'- CAGAAGTAGGTGGCTGAGTCTCC -3'
Posted On2019-09-13