Incidental Mutation 'R7389:Olfr111'
ID573328
Institutional Source Beutler Lab
Gene Symbol Olfr111
Ensembl Gene ENSMUSG00000090675
Gene Nameolfactory receptor 111
SynonymsMOR249-1P, GA_x6K02T2PSCP-1989071-1990024
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.496) question?
Stock #R7389 (G1)
Quality Score225.009
Status Validated
Chromosome17
Chromosomal Location37508030-37532449 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 37530657 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Glycine at position 227 (R227G)
Ref Sequence ENSEMBL: ENSMUSP00000150585 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000097325] [ENSMUST00000214259] [ENSMUST00000215424]
Predicted Effect possibly damaging
Transcript: ENSMUST00000097325
AA Change: R227G

PolyPhen 2 Score 0.716 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000094933
Gene: ENSMUSG00000090675
AA Change: R227G

DomainStartEndE-ValueType
Pfam:7tm_4 31 307 5.4e-54 PFAM
Pfam:7TM_GPCR_Srsx 35 302 1.5e-5 PFAM
Pfam:7tm_1 41 290 1.4e-28 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000214259
AA Change: R227G

PolyPhen 2 Score 0.716 (Sensitivity: 0.86; Specificity: 0.92)
Predicted Effect possibly damaging
Transcript: ENSMUST00000215424
AA Change: R227G

PolyPhen 2 Score 0.716 (Sensitivity: 0.86; Specificity: 0.92)
Meta Mutation Damage Score 0.2155 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 98% (49/50)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Anxa11 C A 14: 25,872,888 P182Q probably damaging Het
Asns C A 6: 7,689,291 L70F probably damaging Het
Cd163l1 A G 7: 140,228,791 K872E possibly damaging Het
Cntrl A T 2: 35,127,517 K445N probably benign Het
Cyp2c50 G T 19: 40,090,663 R150L probably benign Het
Dqx1 G T 6: 83,064,794 S539I probably null Het
Dusp9 TAAAGCGGAGGCCAAAGCGGAGGCCAAAGCGGAGGCTAAAGCGGAGGCCAAAGCGGAGGCCAAAGCGGAGGCCAAAGCGGAGGCTAAAGCGGAGGCCAAAGCGGAGGCCAAAG TAAAGCGGAGGCCAAAGCGGAGGCCAAAGCGGAGGCTAAAGCGGAGGCCAAAGCGGAGGCCAAAG X: 73,640,611 probably benign Het
Epha3 T C 16: 63,772,984 E247G probably damaging Het
Etl4 C T 2: 20,785,093 Q801* probably null Het
Fabp2 G T 3: 122,895,365 probably benign Het
Fsip2 G A 2: 82,988,796 V4958I possibly damaging Het
Fstl3 G A 10: 79,780,031 C117Y probably damaging Het
Hdgfl2 T G 17: 56,099,389 probably null Het
Igfn1 T C 1: 135,967,047 D1927G probably benign Het
Ino80 A C 2: 119,442,529 S489A probably benign Het
Krt15 A T 11: 100,135,560 V100E possibly damaging Het
Lrriq3 A G 3: 155,188,104 T481A probably benign Het
Map2k3 A T 11: 60,932,036 probably benign Het
Matr3 A G 18: 35,584,585 T617A probably benign Het
Mybpc2 T G 7: 44,505,604 T960P probably benign Het
Ncoa2 T C 1: 13,186,825 N150S possibly damaging Het
Nup153 A T 13: 46,700,987 probably null Het
Obscn A G 11: 59,036,400 L5498P probably benign Het
Olfr1444 G T 19: 12,862,617 V281L probably benign Het
Paqr8 C A 1: 20,935,165 P181Q probably damaging Het
Pcdhgb4 T C 18: 37,722,363 Y604H probably damaging Het
Pja2 T A 17: 64,297,727 E487V probably damaging Het
Pnpla6 C T 8: 3,543,981 R1331* probably null Het
Ppl T A 16: 5,106,713 probably null Het
Rhbdl3 T A 11: 80,346,839 M299K possibly damaging Het
Slc26a9 A G 1: 131,769,248 *791W probably null Het
Slc7a2 A G 8: 40,912,515 Y461C probably benign Het
Sptb G T 12: 76,624,229 Q447K probably damaging Het
Ssh1 A T 5: 113,958,831 I205N probably benign Het
Stab1 C T 14: 31,147,239 V1511I probably benign Het
Tex19.1 T C 11: 121,147,160 W115R possibly damaging Het
Tinf2 G T 14: 55,680,710 probably null Het
Tmeff1 A G 4: 48,617,097 probably null Het
Tnip2 G T 5: 34,513,801 Q33K probably benign Het
Traf3 C A 12: 111,237,753 L59M probably damaging Het
Trav14d-3-dv8 T C 14: 53,078,871 Y63H possibly damaging Het
Trim11 C T 11: 58,990,655 S458L probably damaging Het
Tspan18 A T 2: 93,209,927 V161E probably benign Het
Usf3 T A 16: 44,217,941 V928E probably benign Het
Usp29 G A 7: 6,963,458 V767I possibly damaging Het
Usp34 T G 11: 23,345,200 F287L Het
Vmn1r213 T C 13: 23,012,386 C380R probably benign Het
Zfyve9 A G 4: 108,693,318 probably null Het
Other mutations in Olfr111
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01870:Olfr111 APN 17 37530664 missense probably benign 0.00
IGL02472:Olfr111 APN 17 37530749 missense probably damaging 1.00
IGL02511:Olfr111 APN 17 37529979 start codon destroyed probably null 0.99
R0335:Olfr111 UTSW 17 37530642 missense probably benign 0.01
R2006:Olfr111 UTSW 17 37530706 missense probably damaging 1.00
R3757:Olfr111 UTSW 17 37530355 missense probably damaging 1.00
R4167:Olfr111 UTSW 17 37530006 missense possibly damaging 0.65
R4904:Olfr111 UTSW 17 37530631 missense probably damaging 1.00
R4952:Olfr111 UTSW 17 37530750 missense possibly damaging 0.48
R7366:Olfr111 UTSW 17 37530817 missense probably damaging 0.99
R7510:Olfr111 UTSW 17 37530589 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- CTGGACATGTGGGTTTCTCAAC -3'
(R):5'- GGGTGTGAAAACACTATACAGC -3'

Sequencing Primer
(F):5'- GTGTTGCACACCGTTCTGAC -3'
(R):5'- TACAGCACTGAGATCAATCTGTC -3'
Posted On2019-09-13