Incidental Mutation 'R7389:Hdgfl2'
ID573329
Institutional Source Beutler Lab
Gene Symbol Hdgfl2
Ensembl Gene ENSMUSG00000002833
Gene NameHDGF like 2
SynonymsHdgfrp2, HRP-2
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.189) question?
Stock #R7389 (G1)
Quality Score225.009
Status Validated
Chromosome17
Chromosomal Location56079634-56100607 bp(+) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) T to G at 56099389 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000002911 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000002908] [ENSMUST00000002911] [ENSMUST00000190703] [ENSMUST00000225843] [ENSMUST00000226053]
Predicted Effect probably benign
Transcript: ENSMUST00000002908
SMART Domains Protein: ENSMUSP00000002908
Gene: ENSMUSG00000002831

DomainStartEndE-ValueType
low complexity region 19 31 N/A INTRINSIC
internal_repeat_2 74 335 9.44e-7 PROSPERO
internal_repeat_1 103 467 2.72e-12 PROSPERO
internal_repeat_2 343 701 9.44e-7 PROSPERO
internal_repeat_1 598 1090 2.72e-12 PROSPERO
low complexity region 1124 1136 N/A INTRINSIC
Pfam:Perilipin 1144 1385 2.3e-22 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000002911
SMART Domains Protein: ENSMUSP00000002911
Gene: ENSMUSG00000002833

DomainStartEndE-ValueType
PWWP 5 62 1.78e-19 SMART
low complexity region 90 109 N/A INTRINSIC
low complexity region 127 136 N/A INTRINSIC
low complexity region 137 153 N/A INTRINSIC
low complexity region 163 175 N/A INTRINSIC
low complexity region 181 196 N/A INTRINSIC
low complexity region 212 243 N/A INTRINSIC
low complexity region 252 272 N/A INTRINSIC
low complexity region 273 300 N/A INTRINSIC
low complexity region 301 311 N/A INTRINSIC
coiled coil region 321 364 N/A INTRINSIC
low complexity region 398 411 N/A INTRINSIC
Pfam:LEDGF 468 569 2.8e-31 PFAM
internal_repeat_1 575 644 2.5e-5 PROSPERO
Predicted Effect probably benign
Transcript: ENSMUST00000190703
SMART Domains Protein: ENSMUSP00000139859
Gene: ENSMUSG00000002831

DomainStartEndE-ValueType
low complexity region 19 31 N/A INTRINSIC
internal_repeat_2 74 335 9.44e-7 PROSPERO
internal_repeat_1 103 467 2.72e-12 PROSPERO
internal_repeat_2 343 701 9.44e-7 PROSPERO
internal_repeat_1 598 1090 2.72e-12 PROSPERO
Pfam:Perilipin 1110 1385 1.4e-16 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000225843
Predicted Effect probably null
Transcript: ENSMUST00000226053
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 98% (49/50)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the hepatoma-derived growth factor (HDGF) family. The protein includes an N-terminal PWWP domain that binds to methyl-lysine-containing histones, with specific binding of this protein to tri-methylated lysines 36 and 79 of histone H3, and di- and tri-methylated lysine 20 of histone H4. The protein functions in LEDGF/p75-independent HIV-1 replication by determining HIV-1 integration site selection. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Apr 2014]
PHENOTYPE: Homozygous mice exhibit an increased mean serum alkaline phosphatase level compared to controls. Female mutants exhibited a decreased mean skin fibroblast proliferation rate. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Anxa11 C A 14: 25,872,888 P182Q probably damaging Het
Asns C A 6: 7,689,291 L70F probably damaging Het
Cd163l1 A G 7: 140,228,791 K872E possibly damaging Het
Cntrl A T 2: 35,127,517 K445N probably benign Het
Cyp2c50 G T 19: 40,090,663 R150L probably benign Het
Dqx1 G T 6: 83,064,794 S539I probably null Het
Dusp9 TAAAGCGGAGGCCAAAGCGGAGGCCAAAGCGGAGGCTAAAGCGGAGGCCAAAGCGGAGGCCAAAGCGGAGGCCAAAGCGGAGGCTAAAGCGGAGGCCAAAGCGGAGGCCAAAG TAAAGCGGAGGCCAAAGCGGAGGCCAAAGCGGAGGCTAAAGCGGAGGCCAAAGCGGAGGCCAAAG X: 73,640,611 probably benign Het
Epha3 T C 16: 63,772,984 E247G probably damaging Het
Etl4 C T 2: 20,785,093 Q801* probably null Het
Fabp2 G T 3: 122,895,365 probably benign Het
Fsip2 G A 2: 82,988,796 V4958I possibly damaging Het
Fstl3 G A 10: 79,780,031 C117Y probably damaging Het
Igfn1 T C 1: 135,967,047 D1927G probably benign Het
Ino80 A C 2: 119,442,529 S489A probably benign Het
Krt15 A T 11: 100,135,560 V100E possibly damaging Het
Lrriq3 A G 3: 155,188,104 T481A probably benign Het
Map2k3 A T 11: 60,932,036 probably benign Het
Matr3 A G 18: 35,584,585 T617A probably benign Het
Mybpc2 T G 7: 44,505,604 T960P probably benign Het
Ncoa2 T C 1: 13,186,825 N150S possibly damaging Het
Nup153 A T 13: 46,700,987 probably null Het
Obscn A G 11: 59,036,400 L5498P probably benign Het
Olfr111 A G 17: 37,530,657 R227G possibly damaging Het
Olfr1444 G T 19: 12,862,617 V281L probably benign Het
Paqr8 C A 1: 20,935,165 P181Q probably damaging Het
Pcdhgb4 T C 18: 37,722,363 Y604H probably damaging Het
Pja2 T A 17: 64,297,727 E487V probably damaging Het
Pnpla6 C T 8: 3,543,981 R1331* probably null Het
Ppl T A 16: 5,106,713 probably null Het
Rhbdl3 T A 11: 80,346,839 M299K possibly damaging Het
Slc26a9 A G 1: 131,769,248 *791W probably null Het
Slc7a2 A G 8: 40,912,515 Y461C probably benign Het
Sptb G T 12: 76,624,229 Q447K probably damaging Het
Ssh1 A T 5: 113,958,831 I205N probably benign Het
Stab1 C T 14: 31,147,239 V1511I probably benign Het
Tex19.1 T C 11: 121,147,160 W115R possibly damaging Het
Tinf2 G T 14: 55,680,710 probably null Het
Tmeff1 A G 4: 48,617,097 probably null Het
Tnip2 G T 5: 34,513,801 Q33K probably benign Het
Traf3 C A 12: 111,237,753 L59M probably damaging Het
Trav14d-3-dv8 T C 14: 53,078,871 Y63H possibly damaging Het
Trim11 C T 11: 58,990,655 S458L probably damaging Het
Tspan18 A T 2: 93,209,927 V161E probably benign Het
Usf3 T A 16: 44,217,941 V928E probably benign Het
Usp29 G A 7: 6,963,458 V767I possibly damaging Het
Usp34 T G 11: 23,345,200 F287L Het
Vmn1r213 T C 13: 23,012,386 C380R probably benign Het
Zfyve9 A G 4: 108,693,318 probably null Het
Other mutations in Hdgfl2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01446:Hdgfl2 APN 17 56097281 missense possibly damaging 0.94
IGL01486:Hdgfl2 APN 17 56098733 missense possibly damaging 0.84
IGL02977:Hdgfl2 APN 17 56099319 missense possibly damaging 0.71
IGL03196:Hdgfl2 APN 17 56093607 missense probably benign 0.40
IGL03368:Hdgfl2 APN 17 56079746 utr 5 prime probably benign
R0325:Hdgfl2 UTSW 17 56099181 missense possibly damaging 0.95
R0635:Hdgfl2 UTSW 17 56096057 missense probably damaging 0.99
R1914:Hdgfl2 UTSW 17 56096978 missense probably damaging 1.00
R1927:Hdgfl2 UTSW 17 56099874 missense possibly damaging 0.92
R2157:Hdgfl2 UTSW 17 56098691 missense possibly damaging 0.46
R2337:Hdgfl2 UTSW 17 56096987 missense possibly damaging 0.46
R4884:Hdgfl2 UTSW 17 56096265 missense possibly damaging 0.91
R5093:Hdgfl2 UTSW 17 56099217 missense possibly damaging 0.92
R5510:Hdgfl2 UTSW 17 56082118 missense possibly damaging 0.77
R6862:Hdgfl2 UTSW 17 56099211 missense probably damaging 0.97
R7180:Hdgfl2 UTSW 17 56097532 splice site probably null
R7564:Hdgfl2 UTSW 17 56099860 missense unknown
Z1176:Hdgfl2 UTSW 17 56079825 missense possibly damaging 0.79
Z1176:Hdgfl2 UTSW 17 56097016 missense probably null
Z1177:Hdgfl2 UTSW 17 56099343 missense unknown
Predicted Primers PCR Primer
(F):5'- CCAACAAGGATGTGATGGCG -3'
(R):5'- ACTCAGCTGGGGTCAAACTTAC -3'

Sequencing Primer
(F):5'- GAAGGCAGCAGAGGTCTACACC -3'
(R):5'- CAAGCAGTTTAAGTGCATATAGGTGC -3'
Posted On2019-09-13