Incidental Mutation 'R7389:Olfr1444'
ID573333
Institutional Source Beutler Lab
Gene Symbol Olfr1444
Ensembl Gene ENSMUSG00000046272
Gene Nameolfactory receptor 1444
SynonymsMOR202-4, GA_x6K02T2RE5P-3191201-3192160
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.275) question?
Stock #R7389 (G1)
Quality Score225.009
Status Validated
Chromosome19
Chromosomal Location12857283-12863440 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 12862617 bp
ZygosityHeterozygous
Amino Acid Change Valine to Leucine at position 281 (V281L)
Ref Sequence ENSEMBL: ENSMUSP00000150212 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000059675] [ENSMUST00000213606]
Predicted Effect probably benign
Transcript: ENSMUST00000059675
AA Change: V281L

PolyPhen 2 Score 0.037 (Sensitivity: 0.94; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000062460
Gene: ENSMUSG00000046272
AA Change: V281L

DomainStartEndE-ValueType
Pfam:7tm_4 32 308 1.6e-54 PFAM
Pfam:7tm_1 42 291 5.3e-23 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000213606
AA Change: V281L

PolyPhen 2 Score 0.037 (Sensitivity: 0.94; Specificity: 0.82)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 98% (49/50)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Anxa11 C A 14: 25,872,888 P182Q probably damaging Het
Asns C A 6: 7,689,291 L70F probably damaging Het
Cd163l1 A G 7: 140,228,791 K872E possibly damaging Het
Cntrl A T 2: 35,127,517 K445N probably benign Het
Cyp2c50 G T 19: 40,090,663 R150L probably benign Het
Dqx1 G T 6: 83,064,794 S539I probably null Het
Dusp9 TAAAGCGGAGGCCAAAGCGGAGGCCAAAGCGGAGGCTAAAGCGGAGGCCAAAGCGGAGGCCAAAGCGGAGGCCAAAGCGGAGGCTAAAGCGGAGGCCAAAGCGGAGGCCAAAG TAAAGCGGAGGCCAAAGCGGAGGCCAAAGCGGAGGCTAAAGCGGAGGCCAAAGCGGAGGCCAAAG X: 73,640,611 probably benign Het
Epha3 T C 16: 63,772,984 E247G probably damaging Het
Etl4 C T 2: 20,785,093 Q801* probably null Het
Fabp2 G T 3: 122,895,365 probably benign Het
Fsip2 G A 2: 82,988,796 V4958I possibly damaging Het
Fstl3 G A 10: 79,780,031 C117Y probably damaging Het
Hdgfl2 T G 17: 56,099,389 probably null Het
Igfn1 T C 1: 135,967,047 D1927G probably benign Het
Ino80 A C 2: 119,442,529 S489A probably benign Het
Krt15 A T 11: 100,135,560 V100E possibly damaging Het
Lrriq3 A G 3: 155,188,104 T481A probably benign Het
Map2k3 A T 11: 60,932,036 probably benign Het
Matr3 A G 18: 35,584,585 T617A probably benign Het
Mybpc2 T G 7: 44,505,604 T960P probably benign Het
Ncoa2 T C 1: 13,186,825 N150S possibly damaging Het
Nup153 A T 13: 46,700,987 probably null Het
Obscn A G 11: 59,036,400 L5498P probably benign Het
Olfr111 A G 17: 37,530,657 R227G possibly damaging Het
Paqr8 C A 1: 20,935,165 P181Q probably damaging Het
Pcdhgb4 T C 18: 37,722,363 Y604H probably damaging Het
Pja2 T A 17: 64,297,727 E487V probably damaging Het
Pnpla6 C T 8: 3,543,981 R1331* probably null Het
Ppl T A 16: 5,106,713 probably null Het
Rhbdl3 T A 11: 80,346,839 M299K possibly damaging Het
Slc26a9 A G 1: 131,769,248 *791W probably null Het
Slc7a2 A G 8: 40,912,515 Y461C probably benign Het
Sptb G T 12: 76,624,229 Q447K probably damaging Het
Ssh1 A T 5: 113,958,831 I205N probably benign Het
Stab1 C T 14: 31,147,239 V1511I probably benign Het
Tex19.1 T C 11: 121,147,160 W115R possibly damaging Het
Tinf2 G T 14: 55,680,710 probably null Het
Tmeff1 A G 4: 48,617,097 probably null Het
Tnip2 G T 5: 34,513,801 Q33K probably benign Het
Traf3 C A 12: 111,237,753 L59M probably damaging Het
Trav14d-3-dv8 T C 14: 53,078,871 Y63H possibly damaging Het
Trim11 C T 11: 58,990,655 S458L probably damaging Het
Tspan18 A T 2: 93,209,927 V161E probably benign Het
Usf3 T A 16: 44,217,941 V928E probably benign Het
Usp29 G A 7: 6,963,458 V767I possibly damaging Het
Usp34 T G 11: 23,345,200 F287L Het
Vmn1r213 T C 13: 23,012,386 C380R probably benign Het
Zfyve9 A G 4: 108,693,318 probably null Het
Other mutations in Olfr1444
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01668:Olfr1444 APN 19 12861867 missense probably benign 0.00
IGL01963:Olfr1444 APN 19 12862382 missense probably benign 0.00
IGL02030:Olfr1444 APN 19 12862435 missense probably benign 0.00
IGL02178:Olfr1444 APN 19 12862543 missense possibly damaging 0.49
IGL02641:Olfr1444 APN 19 12862202 nonsense probably null
R0311:Olfr1444 UTSW 19 12861869 missense probably benign 0.01
R0543:Olfr1444 UTSW 19 12861888 missense probably benign 0.00
R0815:Olfr1444 UTSW 19 12862644 missense probably benign 0.00
R2034:Olfr1444 UTSW 19 12861787 missense possibly damaging 0.82
R2078:Olfr1444 UTSW 19 12862387 missense probably benign 0.05
R2431:Olfr1444 UTSW 19 12862606 missense probably damaging 1.00
R3032:Olfr1444 UTSW 19 12861918 missense probably benign 0.00
R3932:Olfr1444 UTSW 19 12862630 missense possibly damaging 0.95
R4498:Olfr1444 UTSW 19 12862669 missense probably damaging 1.00
R4654:Olfr1444 UTSW 19 12862232 nonsense probably null
R4708:Olfr1444 UTSW 19 12861897 missense probably benign 0.00
R4823:Olfr1444 UTSW 19 12861816 missense probably benign 0.04
R4938:Olfr1444 UTSW 19 12862552 missense probably damaging 1.00
R4980:Olfr1444 UTSW 19 12862020 missense probably benign
R5580:Olfr1444 UTSW 19 12861804 missense possibly damaging 0.59
R5622:Olfr1444 UTSW 19 12862299 missense probably benign 0.08
R5671:Olfr1444 UTSW 19 12861807 missense probably benign 0.02
R6149:Olfr1444 UTSW 19 12862359 missense probably benign 0.02
R6683:Olfr1444 UTSW 19 12862650 missense probably damaging 0.98
R7392:Olfr1444 UTSW 19 12862587 missense probably benign 0.18
R7461:Olfr1444 UTSW 19 12861777 start codon destroyed probably benign 0.00
R7613:Olfr1444 UTSW 19 12861777 start codon destroyed probably benign 0.00
R7698:Olfr1444 UTSW 19 12862713 missense possibly damaging 0.69
R7717:Olfr1444 UTSW 19 12861795 missense probably benign 0.07
R7892:Olfr1444 UTSW 19 12862479 nonsense probably null
R7975:Olfr1444 UTSW 19 12862479 nonsense probably null
Z1088:Olfr1444 UTSW 19 12862284 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGCCTCAATCCATGCTGCAG -3'
(R):5'- TCAAAAGTTGCATTGCCCAG -3'

Sequencing Primer
(F):5'- GCACACACATCAGTAAATTGGTTGTC -3'
(R):5'- AGGAGGCGATCTATCCCTTAC -3'
Posted On2019-09-13