Incidental Mutation 'R0648:Ccdc18'
ID 57334
Institutional Source Beutler Lab
Gene Symbol Ccdc18
Ensembl Gene ENSMUSG00000056531
Gene Name coiled-coil domain containing 18
Synonyms 1700021E15Rik, 4932411G06Rik
MMRRC Submission 038833-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R0648 (G1)
Quality Score 225
Status Validated
Chromosome 5
Chromosomal Location 108280741-108381494 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 108283426 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Threonine at position 46 (S46T)
Ref Sequence ENSEMBL: ENSMUSP00000142963 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000002837] [ENSMUST00000047677] [ENSMUST00000061203] [ENSMUST00000117759] [ENSMUST00000118036] [ENSMUST00000119437] [ENSMUST00000197718] [ENSMUST00000119784]
AlphaFold Q640L5
Predicted Effect probably benign
Transcript: ENSMUST00000002837
SMART Domains Protein: ENSMUSP00000002837
Gene: ENSMUSG00000063406

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
EMP24_GP25L 35 222 5e-58 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000047677
AA Change: S46T

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000036507
Gene: ENSMUSG00000056531
AA Change: S46T

DomainStartEndE-ValueType
coiled coil region 109 140 N/A INTRINSIC
coiled coil region 168 320 N/A INTRINSIC
coiled coil region 344 405 N/A INTRINSIC
coiled coil region 507 1307 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000061203
SMART Domains Protein: ENSMUSP00000056449
Gene: ENSMUSG00000063406

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
Pfam:EMP24_GP25L 35 112 4.2e-15 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000117759
SMART Domains Protein: ENSMUSP00000112612
Gene: ENSMUSG00000063406

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
Pfam:EMP24_GP25L 35 100 4.9e-15 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000118036
SMART Domains Protein: ENSMUSP00000113922
Gene: ENSMUSG00000063406

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
Pfam:EMP24_GP25L 35 99 1.6e-14 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000119437
SMART Domains Protein: ENSMUSP00000112406
Gene: ENSMUSG00000063406

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
EMP24_GP25L 35 160 9.65e-10 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000197718
AA Change: S46T

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000142963
Gene: ENSMUSG00000056531
AA Change: S46T

DomainStartEndE-ValueType
coiled coil region 109 140 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000200463
Predicted Effect probably benign
Transcript: ENSMUST00000119784
SMART Domains Protein: ENSMUSP00000113422
Gene: ENSMUSG00000063406

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
Pfam:EMP24_GP25L 35 96 2.4e-14 PFAM
Meta Mutation Damage Score 0.1059 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.6%
  • 20x: 96.0%
Validation Efficiency 100% (80/80)
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc5 A G 16: 20,184,632 (GRCm39) V1009A possibly damaging Het
Acta2 T C 19: 34,225,934 (GRCm39) I87V probably benign Het
Arid1a A G 4: 133,412,515 (GRCm39) Y1560H unknown Het
Bcor C T X: 11,925,290 (GRCm39) R102Q probably damaging Het
Camsap2 A T 1: 136,232,057 (GRCm39) D179E probably damaging Het
Ccdc168 A G 1: 44,095,723 (GRCm39) S1792P possibly damaging Het
Cdc73 T C 1: 143,571,200 (GRCm39) T80A probably benign Het
Cdh20 T A 1: 109,993,337 (GRCm39) probably benign Het
Cenpe G A 3: 134,935,843 (GRCm39) G426D probably damaging Het
Cenpt A G 8: 106,571,592 (GRCm39) V487A probably damaging Het
Clec2m A G 6: 129,307,932 (GRCm39) F46L probably benign Het
Col4a1 G A 8: 11,296,892 (GRCm39) P84S unknown Het
Dennd2d A G 3: 106,407,871 (GRCm39) I450M probably damaging Het
Dhps C A 8: 85,799,911 (GRCm39) probably null Het
Ebf1 A T 11: 44,882,337 (GRCm39) H431L probably damaging Het
Efcab6 A G 15: 83,817,265 (GRCm39) probably benign Het
Egflam T C 15: 7,237,190 (GRCm39) H990R probably damaging Het
Ercc6l2 A G 13: 63,992,459 (GRCm39) T303A probably benign Het
Fam167b T C 4: 129,472,150 (GRCm39) K7E probably benign Het
Fgd3 T C 13: 49,450,049 (GRCm39) I67V probably benign Het
Fhip1a A C 3: 85,637,921 (GRCm39) V126G probably damaging Het
Fn1 A T 1: 71,636,744 (GRCm39) V2045D possibly damaging Het
Gnl1 A G 17: 36,293,490 (GRCm39) N225S probably damaging Het
Gpx6 A T 13: 21,503,047 (GRCm39) N154Y probably benign Het
H2bc21 A G 3: 96,128,851 (GRCm39) S124G probably benign Het
Haus8 C A 8: 71,709,174 (GRCm39) G79V probably damaging Het
Hdgfl1 A T 13: 26,953,836 (GRCm39) L79Q probably damaging Het
Impdh2 T C 9: 108,440,665 (GRCm39) Y83H probably benign Het
Lama2 T C 10: 26,865,372 (GRCm39) T2929A probably benign Het
Lpin2 T C 17: 71,536,307 (GRCm39) S199P probably benign Het
Moap1 T C 12: 102,708,776 (GRCm39) T258A probably benign Het
Mrps35 C A 6: 146,957,443 (GRCm39) S156* probably null Het
Mrtfa A G 15: 80,901,121 (GRCm39) S457P probably damaging Het
Mtbp C T 15: 55,466,597 (GRCm39) P537S probably benign Het
Ncstn C A 1: 171,895,454 (GRCm39) V565F probably benign Het
Nhsl1 A G 10: 18,407,474 (GRCm39) N1536S possibly damaging Het
Nkain4 T C 2: 180,584,905 (GRCm39) Q103R possibly damaging Het
Nsun2 T A 13: 69,775,706 (GRCm39) N383K probably damaging Het
Or13p4 C T 4: 118,547,269 (GRCm39) V127I probably benign Het
Or6c33 A G 10: 129,853,350 (GRCm39) N40S probably damaging Het
Parp1 C T 1: 180,428,005 (GRCm39) probably benign Het
Pkd1 G A 17: 24,813,911 (GRCm39) R4125H probably damaging Het
Plxnd1 T C 6: 115,970,962 (GRCm39) I269V possibly damaging Het
Polr1f C T 12: 33,487,999 (GRCm39) Q305* probably null Het
Ppp1r36dn A G 12: 76,498,070 (GRCm39) noncoding transcript Het
Qrich1 T A 9: 108,422,076 (GRCm39) N563K probably damaging Het
Rab3il1 TGAAG TGAAGAAG 19: 10,004,752 (GRCm39) probably benign Het
Rell1 G A 5: 64,082,088 (GRCm39) T271M probably benign Het
Rgl1 A G 1: 152,412,016 (GRCm39) probably null Het
Rph3a C T 5: 121,097,333 (GRCm39) R261H possibly damaging Het
Ryr2 A T 13: 11,739,219 (GRCm39) M2161K possibly damaging Het
Scaf11 T C 15: 96,316,339 (GRCm39) N1075S possibly damaging Het
Serpina3j A G 12: 104,280,938 (GRCm39) D37G probably benign Het
Siah2 A G 3: 58,583,635 (GRCm39) V217A probably damaging Het
Sik2 T C 9: 50,810,045 (GRCm39) D506G probably benign Het
Skap2 A C 6: 51,856,765 (GRCm39) V279G probably benign Het
Slc8a3 G T 12: 81,361,220 (GRCm39) T533N probably damaging Het
Slc9a7 A T X: 20,028,659 (GRCm39) probably benign Het
Snai3 G T 8: 123,181,733 (GRCm39) F241L probably damaging Het
Speg T C 1: 75,404,622 (GRCm39) S2805P probably benign Het
Spink5 A T 18: 44,132,864 (GRCm39) probably benign Het
Tctn1 C T 5: 122,389,761 (GRCm39) E254K probably benign Het
Tdrd3 C T 14: 87,709,618 (GRCm39) T100M probably damaging Het
Tex47 T C 5: 7,355,215 (GRCm39) V132A probably benign Het
Thbs3 A G 3: 89,123,972 (GRCm39) probably null Het
Tigit T A 16: 43,482,401 (GRCm39) Y111F probably damaging Het
Tmem245 A G 4: 56,906,270 (GRCm39) I148T probably benign Het
Tmem97 A G 11: 78,441,365 (GRCm39) Y39H probably benign Het
Tnks2 T A 19: 36,839,474 (GRCm39) probably null Het
Trp53bp1 A G 2: 121,066,188 (GRCm39) V846A probably benign Het
Tulp2 T G 7: 45,169,210 (GRCm39) I259S probably damaging Het
Ubxn1 G A 19: 8,851,612 (GRCm39) R215H probably damaging Het
Vmn1r17 A G 6: 57,337,460 (GRCm39) F253L probably damaging Het
Vmn2r10 T C 5: 109,143,782 (GRCm39) M723V probably benign Het
Xndc1 T C 7: 101,728,031 (GRCm39) V14A possibly damaging Het
Xpnpep1 A G 19: 52,986,294 (GRCm39) probably benign Het
Yes1 T A 5: 32,812,862 (GRCm39) M322K possibly damaging Het
Zdhhc14 C A 17: 5,543,877 (GRCm39) N52K probably benign Het
Zfp42 A G 8: 43,749,015 (GRCm39) V162A probably benign Het
Other mutations in Ccdc18
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00836:Ccdc18 APN 5 108,328,391 (GRCm39) missense probably benign 0.01
IGL01380:Ccdc18 APN 5 108,328,753 (GRCm39) missense probably damaging 0.96
IGL01405:Ccdc18 APN 5 108,350,052 (GRCm39) splice site probably benign
IGL01718:Ccdc18 APN 5 108,349,214 (GRCm39) missense possibly damaging 0.81
IGL02098:Ccdc18 APN 5 108,349,977 (GRCm39) missense probably damaging 1.00
IGL02227:Ccdc18 APN 5 108,296,788 (GRCm39) missense possibly damaging 0.89
IGL02391:Ccdc18 APN 5 108,283,918 (GRCm39) missense probably damaging 1.00
IGL02794:Ccdc18 APN 5 108,319,614 (GRCm39) missense probably benign 0.00
IGL02808:Ccdc18 APN 5 108,283,835 (GRCm39) splice site probably benign
IGL02880:Ccdc18 APN 5 108,283,310 (GRCm39) missense probably benign 0.31
IGL03069:Ccdc18 APN 5 108,376,767 (GRCm39) missense probably damaging 1.00
IGL03390:Ccdc18 APN 5 108,359,997 (GRCm39) missense probably damaging 1.00
PIT4402001:Ccdc18 UTSW 5 108,306,485 (GRCm39) missense possibly damaging 0.94
R0004:Ccdc18 UTSW 5 108,309,566 (GRCm39) missense possibly damaging 0.52
R0112:Ccdc18 UTSW 5 108,321,627 (GRCm39) missense probably damaging 1.00
R0295:Ccdc18 UTSW 5 108,321,655 (GRCm39) missense probably damaging 1.00
R0546:Ccdc18 UTSW 5 108,322,830 (GRCm39) missense probably benign 0.06
R0619:Ccdc18 UTSW 5 108,328,282 (GRCm39) missense probably benign 0.04
R0648:Ccdc18 UTSW 5 108,322,853 (GRCm39) missense probably damaging 1.00
R0666:Ccdc18 UTSW 5 108,311,530 (GRCm39) missense probably benign 0.19
R1271:Ccdc18 UTSW 5 108,349,982 (GRCm39) nonsense probably null
R1509:Ccdc18 UTSW 5 108,336,844 (GRCm39) missense possibly damaging 0.89
R1539:Ccdc18 UTSW 5 108,339,843 (GRCm39) missense probably damaging 1.00
R1542:Ccdc18 UTSW 5 108,360,054 (GRCm39) missense probably benign
R1663:Ccdc18 UTSW 5 108,363,956 (GRCm39) missense probably damaging 1.00
R1865:Ccdc18 UTSW 5 108,341,668 (GRCm39) missense probably benign 0.00
R1870:Ccdc18 UTSW 5 108,368,703 (GRCm39) missense possibly damaging 0.90
R1897:Ccdc18 UTSW 5 108,343,908 (GRCm39) missense probably benign 0.00
R1946:Ccdc18 UTSW 5 108,376,861 (GRCm39) missense probably damaging 1.00
R2420:Ccdc18 UTSW 5 108,376,454 (GRCm39) missense probably damaging 0.96
R2421:Ccdc18 UTSW 5 108,376,454 (GRCm39) missense probably damaging 0.96
R2422:Ccdc18 UTSW 5 108,376,454 (GRCm39) missense probably damaging 0.96
R4078:Ccdc18 UTSW 5 108,306,394 (GRCm39) nonsense probably null
R4079:Ccdc18 UTSW 5 108,306,394 (GRCm39) nonsense probably null
R4244:Ccdc18 UTSW 5 108,296,838 (GRCm39) nonsense probably null
R4409:Ccdc18 UTSW 5 108,368,708 (GRCm39) nonsense probably null
R4428:Ccdc18 UTSW 5 108,283,943 (GRCm39) missense probably benign 0.01
R4455:Ccdc18 UTSW 5 108,309,395 (GRCm39) missense possibly damaging 0.68
R4499:Ccdc18 UTSW 5 108,376,826 (GRCm39) missense possibly damaging 0.62
R4612:Ccdc18 UTSW 5 108,283,307 (GRCm39) missense probably benign 0.01
R4907:Ccdc18 UTSW 5 108,284,007 (GRCm39) missense probably benign 0.01
R4972:Ccdc18 UTSW 5 108,339,869 (GRCm39) missense probably benign
R5039:Ccdc18 UTSW 5 108,306,514 (GRCm39) critical splice donor site probably null
R5835:Ccdc18 UTSW 5 108,288,740 (GRCm39) missense possibly damaging 0.94
R5854:Ccdc18 UTSW 5 108,354,594 (GRCm39) missense possibly damaging 0.79
R6128:Ccdc18 UTSW 5 108,311,625 (GRCm39) missense possibly damaging 0.76
R6229:Ccdc18 UTSW 5 108,319,484 (GRCm39) missense probably benign 0.00
R6271:Ccdc18 UTSW 5 108,322,753 (GRCm39) missense possibly damaging 0.65
R6315:Ccdc18 UTSW 5 108,309,448 (GRCm39) missense probably benign
R6359:Ccdc18 UTSW 5 108,283,391 (GRCm39) missense probably damaging 1.00
R6375:Ccdc18 UTSW 5 108,322,820 (GRCm39) missense possibly damaging 0.79
R6388:Ccdc18 UTSW 5 108,349,214 (GRCm39) missense possibly damaging 0.81
R6415:Ccdc18 UTSW 5 108,309,612 (GRCm39) missense probably benign 0.03
R6560:Ccdc18 UTSW 5 108,339,790 (GRCm39) missense probably benign 0.09
R6645:Ccdc18 UTSW 5 108,286,796 (GRCm39) missense probably benign
R6664:Ccdc18 UTSW 5 108,315,966 (GRCm39) nonsense probably null
R6836:Ccdc18 UTSW 5 108,345,833 (GRCm39) missense probably damaging 1.00
R6947:Ccdc18 UTSW 5 108,309,401 (GRCm39) missense probably benign 0.26
R7009:Ccdc18 UTSW 5 108,321,728 (GRCm39) critical splice donor site probably null
R7052:Ccdc18 UTSW 5 108,309,554 (GRCm39) missense probably benign 0.15
R7058:Ccdc18 UTSW 5 108,341,664 (GRCm39) missense probably benign
R7087:Ccdc18 UTSW 5 108,343,988 (GRCm39) missense probably benign
R7117:Ccdc18 UTSW 5 108,296,835 (GRCm39) missense possibly damaging 0.95
R7176:Ccdc18 UTSW 5 108,315,972 (GRCm39) missense probably benign
R7382:Ccdc18 UTSW 5 108,286,873 (GRCm39) missense probably damaging 1.00
R7477:Ccdc18 UTSW 5 108,368,716 (GRCm39) missense probably damaging 0.98
R7493:Ccdc18 UTSW 5 108,354,483 (GRCm39) nonsense probably null
R7506:Ccdc18 UTSW 5 108,311,605 (GRCm39) missense possibly damaging 0.85
R7635:Ccdc18 UTSW 5 108,376,915 (GRCm39) critical splice donor site probably null
R7690:Ccdc18 UTSW 5 108,376,528 (GRCm39) missense probably benign 0.00
R7748:Ccdc18 UTSW 5 108,296,907 (GRCm39) critical splice donor site probably null
R7812:Ccdc18 UTSW 5 108,328,699 (GRCm39) missense probably benign 0.00
R8017:Ccdc18 UTSW 5 108,376,511 (GRCm39) nonsense probably null
R8019:Ccdc18 UTSW 5 108,376,511 (GRCm39) nonsense probably null
R8172:Ccdc18 UTSW 5 108,311,640 (GRCm39) critical splice donor site probably null
R8177:Ccdc18 UTSW 5 108,345,661 (GRCm39) missense possibly damaging 0.65
R8344:Ccdc18 UTSW 5 108,309,369 (GRCm39) missense possibly damaging 0.88
R8351:Ccdc18 UTSW 5 108,303,663 (GRCm39) missense probably damaging 1.00
R8415:Ccdc18 UTSW 5 108,363,899 (GRCm39) missense probably damaging 1.00
R8451:Ccdc18 UTSW 5 108,303,663 (GRCm39) missense probably damaging 1.00
R8547:Ccdc18 UTSW 5 108,345,725 (GRCm39) missense probably damaging 1.00
R8725:Ccdc18 UTSW 5 108,328,283 (GRCm39) missense possibly damaging 0.66
R9137:Ccdc18 UTSW 5 108,296,856 (GRCm39) missense probably damaging 0.98
R9391:Ccdc18 UTSW 5 108,376,770 (GRCm39) missense probably benign 0.02
R9418:Ccdc18 UTSW 5 108,303,669 (GRCm39) missense probably damaging 1.00
R9536:Ccdc18 UTSW 5 108,286,792 (GRCm39) missense probably benign 0.01
R9565:Ccdc18 UTSW 5 108,339,800 (GRCm39) missense probably damaging 0.99
RF013:Ccdc18 UTSW 5 108,368,582 (GRCm39) missense probably benign 0.05
X0024:Ccdc18 UTSW 5 108,339,788 (GRCm39) missense probably benign 0.01
X0063:Ccdc18 UTSW 5 108,360,063 (GRCm39) missense probably benign
Predicted Primers PCR Primer
(F):5'- ATCTGTTGGTCCTGAGGAGCACCC -3'
(R):5'- AACGTCCCAGGTGGCTAGGTTG -3'

Sequencing Primer
(F):5'- GTGCCAAGCACAGGTTTTTC -3'
(R):5'- GGGTGAGTTCTTCCAAAATAAGCC -3'
Posted On 2013-07-11