Incidental Mutation 'R7390:Sirpb1b'
ID573345
Institutional Source Beutler Lab
Gene Symbol Sirpb1b
Ensembl Gene ENSMUSG00000095028
Gene Namesignal-regulatory protein beta 1B
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.065) question?
Stock #R7390 (G1)
Quality Score225.009
Status Validated
Chromosome3
Chromosomal Location15495751-15575065 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) A to T at 15543040 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Stop codon at position 215 (L215*)
Ref Sequence ENSEMBL: ENSMUSP00000088869 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000091319] [ENSMUST00000192382] [ENSMUST00000195778]
Predicted Effect probably null
Transcript: ENSMUST00000091319
AA Change: L215*
SMART Domains Protein: ENSMUSP00000088869
Gene: ENSMUSG00000095028
AA Change: L215*

DomainStartEndE-ValueType
low complexity region 15 23 N/A INTRINSIC
IG 37 143 8.19e-9 SMART
IGc1 163 236 1.22e-4 SMART
IGc1 266 339 2.21e-5 SMART
transmembrane domain 364 386 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000192382
AA Change: L215*
SMART Domains Protein: ENSMUSP00000142068
Gene: ENSMUSG00000095028
AA Change: L215*

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
IG 37 143 3.3e-11 SMART
IGc1 163 236 5.1e-7 SMART
Pfam:C2-set_2 251 340 1e-4 PFAM
Pfam:Ig_2 251 348 2.7e-1 PFAM
Pfam:C1-set 258 341 1.3e-13 PFAM
transmembrane domain 370 392 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000195778
AA Change: L148*
SMART Domains Protein: ENSMUSP00000141533
Gene: ENSMUSG00000095028
AA Change: L148*

DomainStartEndE-ValueType
Pfam:Ig_2 14 66 5.6e-1 PFAM
Pfam:Ig_3 22 52 7.8e-3 PFAM
Pfam:V-set 24 75 1.9e-7 PFAM
IGc1 96 169 5.1e-7 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 97% (66/68)
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1190002N15Rik A G 9: 94,537,383 S165P probably damaging Het
4930486L24Rik A T 13: 60,844,338 D291E probably benign Het
Abca9 C T 11: 110,145,661 V541I probably benign Het
Adamts15 A T 9: 30,911,108 probably null Het
Adgrg7 A G 16: 56,732,844 I630T probably damaging Het
Ahnak A G 19: 9,003,205 I618V probably benign Het
Amotl2 T A 9: 102,731,690 V801E probably damaging Het
Ankrd17 T C 5: 90,282,920 T1002A probably benign Het
Bmp7 C T 2: 172,870,205 D409N probably damaging Het
Bpifb2 A G 2: 153,889,806 N293S possibly damaging Het
Ccdc162 A G 10: 41,634,048 C854R probably benign Het
Ccdc171 A G 4: 83,818,067 E1225G probably damaging Het
Cep350 T C 1: 155,866,087 E2146G possibly damaging Het
Ces1a A C 8: 93,044,841 probably null Het
Cfap45 T G 1: 172,541,358 D444E probably benign Het
Cfap61 T C 2: 146,001,882 V296A probably benign Het
Cgnl1 C T 9: 71,645,649 R1011H probably benign Het
Cops4 C T 5: 100,543,875 R347C probably damaging Het
D16Ertd472e G T 16: 78,547,688 D177E probably benign Het
Dcdc2a T C 13: 25,107,617 V195A possibly damaging Het
Dpagt1 G A 9: 44,332,022 V285I probably benign Het
Dspp G T 5: 104,175,686 A232S probably damaging Het
Ephx2 G A 14: 66,110,455 Het
Fat1 T C 8: 44,952,474 V754A possibly damaging Het
Fstl3 G A 10: 79,780,031 C117Y probably damaging Het
Gldc A T 19: 30,099,914 S953T possibly damaging Het
Gm1123 T C 9: 99,010,980 N315S probably benign Het
Gm11639 T C 11: 104,724,585 I726T possibly damaging Het
Golga2 A G 2: 32,288,190 E37G Het
Gpr139 T A 7: 119,144,612 Q250L probably benign Het
Grik3 C T 4: 125,649,739 R283C probably damaging Het
Haao A C 17: 83,846,652 V22G probably damaging Het
Hspg2 T A 4: 137,539,179 F1884I probably damaging Het
Hyal3 G A 9: 107,584,967 G67S probably damaging Het
Kbtbd3 T A 9: 4,330,424 I266K probably benign Het
Klhl26 A C 8: 70,452,849 L137R probably damaging Het
Krt15 A T 11: 100,135,560 V100E possibly damaging Het
Lars A G 18: 42,210,018 probably null Het
Lats1 C T 10: 7,702,095 Q328* probably null Het
Lingo3 G A 10: 80,834,629 T489I probably damaging Het
Lmtk2 T C 5: 144,129,443 V65A possibly damaging Het
Lysmd1 T C 3: 95,138,484 S211P probably damaging Het
Med15 C T 16: 17,722,762 S21N unknown Het
Nav1 T C 1: 135,584,918 T135A probably benign Het
Nt5c1a G C 4: 123,208,479 R66T probably benign Het
Pclo T C 5: 14,682,010 Y3509H unknown Het
Pkp4 G A 2: 59,310,140 G397R possibly damaging Het
Ppp1r21 G A 17: 88,549,530 A138T probably benign Het
Pum3 A T 19: 27,424,242 V136D probably benign Het
Rab11fip3 A T 17: 26,068,152 D342E possibly damaging Het
Rcvrn T A 11: 67,700,057 W156R probably damaging Het
Rspry1 C T 8: 94,623,185 T67I probably benign Het
Serpina1d T C 12: 103,767,778 D89G possibly damaging Het
Sgsm3 T A 15: 81,008,820 V366E possibly damaging Het
Shank3 T G 15: 89,549,312 L1420R probably benign Het
Slc16a13 C T 11: 70,218,971 V235I probably benign Het
Slc16a14 T C 1: 84,929,466 D29G probably benign Het
Speer1 T C 5: 11,344,912 V122A probably benign Het
Spns2 T A 11: 72,456,878 T329S possibly damaging Het
Sufu G A 19: 46,450,669 probably null Het
Tll2 A G 19: 41,120,169 probably null Het
Trim10 G A 17: 36,869,881 M1I probably null Het
Trim42 A C 9: 97,359,129 N683K probably damaging Het
Trmt5 A G 12: 73,281,620 S270P probably damaging Het
Vmn1r59 C A 7: 5,453,987 R258L possibly damaging Het
Vmn2r32 A G 7: 7,479,852 L41S probably benign Het
Vmn2r93 A T 17: 18,305,067 E329V probably damaging Het
Ywhae G T 11: 75,764,661 E253* probably null Het
Other mutations in Sirpb1b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01384:Sirpb1b APN 3 15548729 missense probably damaging 0.99
IGL01662:Sirpb1b APN 3 15543184 missense probably damaging 1.00
IGL02025:Sirpb1b APN 3 15548803 missense probably damaging 0.99
F5770:Sirpb1b UTSW 3 15503183 missense probably benign 0.25
R0419:Sirpb1b UTSW 3 15548596 missense probably damaging 1.00
R1538:Sirpb1b UTSW 3 15548759 missense possibly damaging 0.81
R3935:Sirpb1b UTSW 3 15548783 missense probably benign 0.05
R4300:Sirpb1b UTSW 3 15548761 missense probably damaging 1.00
R4373:Sirpb1b UTSW 3 15548761 missense probably damaging 1.00
R4953:Sirpb1b UTSW 3 15548827 missense probably damaging 1.00
R5425:Sirpb1b UTSW 3 15548669 missense probably damaging 1.00
R6340:Sirpb1b UTSW 3 15548665 missense probably damaging 1.00
R6357:Sirpb1b UTSW 3 15503183 missense possibly damaging 0.79
R6723:Sirpb1b UTSW 3 15548798 missense possibly damaging 0.78
R7152:Sirpb1b UTSW 3 15542170 missense probably benign 0.25
R7411:Sirpb1b UTSW 3 15542997 missense probably benign 0.22
R7513:Sirpb1b UTSW 3 15542140 nonsense probably null
R7526:Sirpb1b UTSW 3 15548872 missense probably damaging 1.00
V7583:Sirpb1b UTSW 3 15503183 missense probably benign 0.25
Z1177:Sirpb1b UTSW 3 15574941 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- GTGATCATACTCTGTGACCACCAC -3'
(R):5'- TGTCCCTAAGCAGACAGTGAC -3'

Sequencing Primer
(F):5'- GGTAGTATATAACAGTGCTTGCTAGG -3'
(R):5'- GACAGTGACCTTTACATGCAGATC -3'
Posted On2019-09-13