Incidental Mutation 'R7390:Nt5c1a'
ID573348
Institutional Source Beutler Lab
Gene Symbol Nt5c1a
Ensembl Gene ENSMUSG00000054958
Gene Name5'-nucleotidase, cytosolic IA
SynonymsLOC230718, Cn1a
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.097) question?
Stock #R7390 (G1)
Quality Score225.009
Status Validated
Chromosome4
Chromosomal Location123201504-123216275 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to C at 123208479 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Threonine at position 66 (R66T)
Ref Sequence ENSEMBL: ENSMUSP00000069422 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000068262]
Predicted Effect probably benign
Transcript: ENSMUST00000068262
AA Change: R66T

PolyPhen 2 Score 0.010 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000069422
Gene: ENSMUSG00000054958
AA Change: R66T

DomainStartEndE-ValueType
low complexity region 35 45 N/A INTRINSIC
Pfam:5-nucleotidase 78 350 3.5e-109 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 97% (66/68)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Cytosolic nucleotidases, such as NT5C1A, dephosphorylate nucleoside monophosphates (Hunsucker et al., 2001 [PubMed 11133996]).[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1190002N15Rik A G 9: 94,537,383 S165P probably damaging Het
4930486L24Rik A T 13: 60,844,338 D291E probably benign Het
Abca9 C T 11: 110,145,661 V541I probably benign Het
Adamts15 A T 9: 30,911,108 probably null Het
Adgrg7 A G 16: 56,732,844 I630T probably damaging Het
Ahnak A G 19: 9,003,205 I618V probably benign Het
Amotl2 T A 9: 102,731,690 V801E probably damaging Het
Ankrd17 T C 5: 90,282,920 T1002A probably benign Het
Bmp7 C T 2: 172,870,205 D409N probably damaging Het
Bpifb2 A G 2: 153,889,806 N293S possibly damaging Het
Ccdc162 A G 10: 41,634,048 C854R probably benign Het
Ccdc171 A G 4: 83,818,067 E1225G probably damaging Het
Cep350 T C 1: 155,866,087 E2146G possibly damaging Het
Ces1a A C 8: 93,044,841 probably null Het
Cfap45 T G 1: 172,541,358 D444E probably benign Het
Cfap61 T C 2: 146,001,882 V296A probably benign Het
Cgnl1 C T 9: 71,645,649 R1011H probably benign Het
Cops4 C T 5: 100,543,875 R347C probably damaging Het
D16Ertd472e G T 16: 78,547,688 D177E probably benign Het
Dcdc2a T C 13: 25,107,617 V195A possibly damaging Het
Dpagt1 G A 9: 44,332,022 V285I probably benign Het
Dspp G T 5: 104,175,686 A232S probably damaging Het
Ephx2 G A 14: 66,110,455 Het
Fat1 T C 8: 44,952,474 V754A possibly damaging Het
Fstl3 G A 10: 79,780,031 C117Y probably damaging Het
Gldc A T 19: 30,099,914 S953T possibly damaging Het
Gm1123 T C 9: 99,010,980 N315S probably benign Het
Gm11639 T C 11: 104,724,585 I726T possibly damaging Het
Golga2 A G 2: 32,288,190 E37G Het
Gpr139 T A 7: 119,144,612 Q250L probably benign Het
Grik3 C T 4: 125,649,739 R283C probably damaging Het
Haao A C 17: 83,846,652 V22G probably damaging Het
Hspg2 T A 4: 137,539,179 F1884I probably damaging Het
Hyal3 G A 9: 107,584,967 G67S probably damaging Het
Kbtbd3 T A 9: 4,330,424 I266K probably benign Het
Klhl26 A C 8: 70,452,849 L137R probably damaging Het
Krt15 A T 11: 100,135,560 V100E possibly damaging Het
Lars A G 18: 42,210,018 probably null Het
Lats1 C T 10: 7,702,095 Q328* probably null Het
Lingo3 G A 10: 80,834,629 T489I probably damaging Het
Lmtk2 T C 5: 144,129,443 V65A possibly damaging Het
Lysmd1 T C 3: 95,138,484 S211P probably damaging Het
Med15 C T 16: 17,722,762 S21N unknown Het
Nav1 T C 1: 135,584,918 T135A probably benign Het
Pclo T C 5: 14,682,010 Y3509H unknown Het
Pkp4 G A 2: 59,310,140 G397R possibly damaging Het
Ppp1r21 G A 17: 88,549,530 A138T probably benign Het
Pum3 A T 19: 27,424,242 V136D probably benign Het
Rab11fip3 A T 17: 26,068,152 D342E possibly damaging Het
Rcvrn T A 11: 67,700,057 W156R probably damaging Het
Rspry1 C T 8: 94,623,185 T67I probably benign Het
Serpina1d T C 12: 103,767,778 D89G possibly damaging Het
Sgsm3 T A 15: 81,008,820 V366E possibly damaging Het
Shank3 T G 15: 89,549,312 L1420R probably benign Het
Sirpb1b A T 3: 15,543,040 L215* probably null Het
Slc16a13 C T 11: 70,218,971 V235I probably benign Het
Slc16a14 T C 1: 84,929,466 D29G probably benign Het
Speer1 T C 5: 11,344,912 V122A probably benign Het
Spns2 T A 11: 72,456,878 T329S possibly damaging Het
Sufu G A 19: 46,450,669 probably null Het
Tll2 A G 19: 41,120,169 probably null Het
Trim10 G A 17: 36,869,881 M1I probably null Het
Trim42 A C 9: 97,359,129 N683K probably damaging Het
Trmt5 A G 12: 73,281,620 S270P probably damaging Het
Vmn1r59 C A 7: 5,453,987 R258L possibly damaging Het
Vmn2r32 A G 7: 7,479,852 L41S probably benign Het
Vmn2r93 A T 17: 18,305,067 E329V probably damaging Het
Ywhae G T 11: 75,764,661 E253* probably null Het
Other mutations in Nt5c1a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01444:Nt5c1a APN 4 123216169 missense probably damaging 1.00
IGL02035:Nt5c1a APN 4 123214102 missense possibly damaging 0.93
IGL02437:Nt5c1a APN 4 123214241 missense probably benign 0.25
IGL02877:Nt5c1a APN 4 123216074 missense probably damaging 1.00
R1628:Nt5c1a UTSW 4 123208491 missense possibly damaging 0.65
R2273:Nt5c1a UTSW 4 123216080 missense probably damaging 1.00
R2275:Nt5c1a UTSW 4 123216080 missense probably damaging 1.00
R4433:Nt5c1a UTSW 4 123215896 missense probably benign 0.01
R4826:Nt5c1a UTSW 4 123208572 missense probably damaging 1.00
R5328:Nt5c1a UTSW 4 123208993 missense possibly damaging 0.90
R5690:Nt5c1a UTSW 4 123215939 missense probably damaging 1.00
R5883:Nt5c1a UTSW 4 123216256 utr 3 prime probably null
R7162:Nt5c1a UTSW 4 123214105 missense probably benign
R7823:Nt5c1a UTSW 4 123208572 missense probably damaging 1.00
R8121:Nt5c1a UTSW 4 123208442 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AATATCACAAGCTCCCGGAG -3'
(R):5'- ATGTGATTGCCTCTGCCAGG -3'

Sequencing Primer
(F):5'- TACACAGGGAGCCAGTCTC -3'
(R):5'- GGTGGTTTCAGGAACTAC -3'
Posted On2019-09-13