Incidental Mutation 'R7390:Lmtk2'
ID 573356
Institutional Source Beutler Lab
Gene Symbol Lmtk2
Ensembl Gene ENSMUSG00000038970
Gene Name lemur tyrosine kinase 2
Synonyms BREK, AATYK2, A330101P12Rik, KPI2, KPI-2, 2900041G10Rik, cprk
MMRRC Submission 045472-MU
Accession Numbers
Essential gene? Possibly essential (E-score: 0.526) question?
Stock # R7390 (G1)
Quality Score 225.009
Status Validated
Chromosome 5
Chromosomal Location 144037254-144125022 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 144066261 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 65 (V65A)
Ref Sequence ENSEMBL: ENSMUSP00000048238 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041804]
AlphaFold Q3TYD6
Predicted Effect possibly damaging
Transcript: ENSMUST00000041804
AA Change: V65A

PolyPhen 2 Score 0.786 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000048238
Gene: ENSMUSG00000038970
AA Change: V65A

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
transmembrane domain 42 61 N/A INTRINSIC
low complexity region 72 88 N/A INTRINSIC
STYKc 136 406 3.4e-39 SMART
low complexity region 924 953 N/A INTRINSIC
low complexity region 1019 1035 N/A INTRINSIC
low complexity region 1104 1117 N/A INTRINSIC
low complexity region 1168 1180 N/A INTRINSIC
low complexity region 1252 1266 N/A INTRINSIC
low complexity region 1354 1367 N/A INTRINSIC
low complexity region 1380 1392 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 97% (66/68)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the protein kinase superfamily and the protein tyrosine kinase family. It contains N-terminal transmembrane helices and a long C-terminal cytoplasmic tail with serine/threonine/tyrosine kinase activity. This protein interacts with several other proteins, such as Inhibitor-2 (Inh2), protein phosphatase-1 (PP1C), p35, and myosin VI. It phosporylates other proteins, and is itself also phosporylated when interacting with cyclin-dependent kinase 5 (cdk5)/p35 complex. This protein involves in nerve growth factor (NGF)-TrkA signalling, and also plays a critical role in endosomal membrane trafficking. Mouse studies suggested an essential role of this protein in spermatogenesis. [provided by RefSeq, Oct 2009]
PHENOTYPE: Mice homozygous for a null mutation in this gene display partial prenatal lethality, male infertility, and azoospermia. [provided by MGI curators]
Allele List at MGI

All alleles(31) : Targeted, knock-out(1) Gene trapped(30)

Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930486L24Rik A T 13: 60,992,152 (GRCm39) D291E probably benign Het
Abca9 C T 11: 110,036,487 (GRCm39) V541I probably benign Het
Adamts15 A T 9: 30,822,404 (GRCm39) probably null Het
Adgrg7 A G 16: 56,553,207 (GRCm39) I630T probably damaging Het
Ahnak A G 19: 8,980,569 (GRCm39) I618V probably benign Het
Amotl2 T A 9: 102,608,889 (GRCm39) V801E probably damaging Het
Ankrd17 T C 5: 90,430,779 (GRCm39) T1002A probably benign Het
Bmp7 C T 2: 172,711,998 (GRCm39) D409N probably damaging Het
Bpifb2 A G 2: 153,731,726 (GRCm39) N293S possibly damaging Het
Ccdc162 A G 10: 41,510,044 (GRCm39) C854R probably benign Het
Ccdc171 A G 4: 83,736,304 (GRCm39) E1225G probably damaging Het
Cep350 T C 1: 155,741,833 (GRCm39) E2146G possibly damaging Het
Ces1a A C 8: 93,771,469 (GRCm39) probably null Het
Cfap45 T G 1: 172,368,925 (GRCm39) D444E probably benign Het
Cfap61 T C 2: 145,843,802 (GRCm39) V296A probably benign Het
Cgnl1 C T 9: 71,552,931 (GRCm39) R1011H probably benign Het
Cops4 C T 5: 100,691,741 (GRCm39) R347C probably damaging Het
D16Ertd472e G T 16: 78,344,576 (GRCm39) D177E probably benign Het
Dcdc2a T C 13: 25,291,600 (GRCm39) V195A possibly damaging Het
Dipk2a A G 9: 94,419,436 (GRCm39) S165P probably damaging Het
Dpagt1 G A 9: 44,243,319 (GRCm39) V285I probably benign Het
Dspp G T 5: 104,323,552 (GRCm39) A232S probably damaging Het
Efcab3 T C 11: 104,615,411 (GRCm39) I726T possibly damaging Het
Ephx2 G A 14: 66,347,904 (GRCm39) Het
Fat1 T C 8: 45,405,511 (GRCm39) V754A possibly damaging Het
Fstl3 G A 10: 79,615,865 (GRCm39) C117Y probably damaging Het
Gldc A T 19: 30,077,314 (GRCm39) S953T possibly damaging Het
Gm1123 T C 9: 98,893,033 (GRCm39) N315S probably benign Het
Golga2 A G 2: 32,178,202 (GRCm39) E37G Het
Gpr139 T A 7: 118,743,835 (GRCm39) Q250L probably benign Het
Grik3 C T 4: 125,543,532 (GRCm39) R283C probably damaging Het
Haao A C 17: 84,154,081 (GRCm39) V22G probably damaging Het
Hspg2 T A 4: 137,266,490 (GRCm39) F1884I probably damaging Het
Hyal3 G A 9: 107,462,166 (GRCm39) G67S probably damaging Het
Kbtbd3 T A 9: 4,330,424 (GRCm39) I266K probably benign Het
Klhl26 A C 8: 70,905,499 (GRCm39) L137R probably damaging Het
Krt15 A T 11: 100,026,386 (GRCm39) V100E possibly damaging Het
Lars1 A G 18: 42,343,083 (GRCm39) probably null Het
Lats1 C T 10: 7,577,859 (GRCm39) Q328* probably null Het
Lingo3 G A 10: 80,670,463 (GRCm39) T489I probably damaging Het
Lysmd1 T C 3: 95,045,795 (GRCm39) S211P probably damaging Het
Med15 C T 16: 17,540,626 (GRCm39) S21N unknown Het
Nav1 T C 1: 135,512,656 (GRCm39) T135A probably benign Het
Nt5c1a G C 4: 123,102,272 (GRCm39) R66T probably benign Het
Pclo T C 5: 14,732,024 (GRCm39) Y3509H unknown Het
Pkp4 G A 2: 59,140,484 (GRCm39) G397R possibly damaging Het
Ppp1r21 G A 17: 88,856,958 (GRCm39) A138T probably benign Het
Pum3 A T 19: 27,401,642 (GRCm39) V136D probably benign Het
Rab11fip3 A T 17: 26,287,126 (GRCm39) D342E possibly damaging Het
Rcvrn T A 11: 67,590,883 (GRCm39) W156R probably damaging Het
Rspry1 C T 8: 95,349,813 (GRCm39) T67I probably benign Het
Serpina1d T C 12: 103,734,037 (GRCm39) D89G possibly damaging Het
Sgsm3 T A 15: 80,893,021 (GRCm39) V366E possibly damaging Het
Shank3 T G 15: 89,433,515 (GRCm39) L1420R probably benign Het
Sirpb1b A T 3: 15,608,100 (GRCm39) L215* probably null Het
Slc16a13 C T 11: 70,109,797 (GRCm39) V235I probably benign Het
Slc16a14 T C 1: 84,907,187 (GRCm39) D29G probably benign Het
Speer1a T C 5: 11,394,879 (GRCm39) V122A probably benign Het
Spns2 T A 11: 72,347,704 (GRCm39) T329S possibly damaging Het
Sufu G A 19: 46,439,108 (GRCm39) probably null Het
Tll2 A G 19: 41,108,608 (GRCm39) probably null Het
Trim10 G A 17: 37,180,773 (GRCm39) M1I probably null Het
Trim42 A C 9: 97,241,182 (GRCm39) N683K probably damaging Het
Trmt5 A G 12: 73,328,394 (GRCm39) S270P probably damaging Het
Vmn1r59 C A 7: 5,456,986 (GRCm39) R258L possibly damaging Het
Vmn2r32 A G 7: 7,482,851 (GRCm39) L41S probably benign Het
Vmn2r93 A T 17: 18,525,329 (GRCm39) E329V probably damaging Het
Ywhae G T 11: 75,655,487 (GRCm39) E253* probably null Het
Other mutations in Lmtk2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00427:Lmtk2 APN 5 144,070,973 (GRCm39) missense probably damaging 1.00
IGL00496:Lmtk2 APN 5 144,111,512 (GRCm39) missense probably benign
IGL00848:Lmtk2 APN 5 144,113,216 (GRCm39) missense probably benign
IGL01450:Lmtk2 APN 5 144,111,520 (GRCm39) missense probably benign 0.03
IGL01833:Lmtk2 APN 5 144,112,753 (GRCm39) nonsense probably null
IGL01967:Lmtk2 APN 5 144,119,597 (GRCm39) missense probably benign
IGL01998:Lmtk2 APN 5 144,112,883 (GRCm39) missense probably damaging 1.00
IGL02106:Lmtk2 APN 5 144,112,769 (GRCm39) missense probably benign 0.03
IGL02147:Lmtk2 APN 5 144,093,754 (GRCm39) missense possibly damaging 0.78
IGL02581:Lmtk2 APN 5 144,085,166 (GRCm39) missense probably damaging 1.00
madagascar UTSW 5 144,111,737 (GRCm39) missense probably benign 0.02
A4554:Lmtk2 UTSW 5 144,103,135 (GRCm39) missense possibly damaging 0.82
R0039:Lmtk2 UTSW 5 144,103,205 (GRCm39) missense probably damaging 1.00
R0039:Lmtk2 UTSW 5 144,103,205 (GRCm39) missense probably damaging 1.00
R0108:Lmtk2 UTSW 5 144,111,103 (GRCm39) missense possibly damaging 0.78
R0367:Lmtk2 UTSW 5 144,111,103 (GRCm39) missense possibly damaging 0.78
R0515:Lmtk2 UTSW 5 144,111,809 (GRCm39) missense possibly damaging 0.77
R1434:Lmtk2 UTSW 5 144,111,407 (GRCm39) missense probably damaging 1.00
R1617:Lmtk2 UTSW 5 144,110,680 (GRCm39) missense probably damaging 1.00
R1760:Lmtk2 UTSW 5 144,110,993 (GRCm39) missense probably damaging 0.99
R1785:Lmtk2 UTSW 5 144,111,806 (GRCm39) missense possibly damaging 0.61
R1786:Lmtk2 UTSW 5 144,111,806 (GRCm39) missense possibly damaging 0.61
R1907:Lmtk2 UTSW 5 144,111,928 (GRCm39) missense probably benign 0.00
R2130:Lmtk2 UTSW 5 144,111,806 (GRCm39) missense possibly damaging 0.61
R2131:Lmtk2 UTSW 5 144,111,806 (GRCm39) missense possibly damaging 0.61
R2132:Lmtk2 UTSW 5 144,111,806 (GRCm39) missense possibly damaging 0.61
R2133:Lmtk2 UTSW 5 144,111,806 (GRCm39) missense possibly damaging 0.61
R2140:Lmtk2 UTSW 5 144,084,433 (GRCm39) missense probably damaging 1.00
R2141:Lmtk2 UTSW 5 144,084,433 (GRCm39) missense probably damaging 1.00
R2210:Lmtk2 UTSW 5 144,084,427 (GRCm39) missense probably damaging 1.00
R2289:Lmtk2 UTSW 5 144,112,924 (GRCm39) missense possibly damaging 0.80
R2312:Lmtk2 UTSW 5 144,110,444 (GRCm39) missense probably damaging 1.00
R2352:Lmtk2 UTSW 5 144,110,729 (GRCm39) missense probably benign 0.05
R3870:Lmtk2 UTSW 5 144,103,245 (GRCm39) splice site probably benign
R4011:Lmtk2 UTSW 5 144,112,697 (GRCm39) missense probably benign 0.01
R4272:Lmtk2 UTSW 5 144,120,044 (GRCm39) missense probably benign 0.05
R4361:Lmtk2 UTSW 5 144,084,482 (GRCm39) missense probably damaging 1.00
R4580:Lmtk2 UTSW 5 144,111,599 (GRCm39) missense possibly damaging 0.56
R4621:Lmtk2 UTSW 5 144,111,752 (GRCm39) missense probably benign 0.02
R4981:Lmtk2 UTSW 5 144,113,265 (GRCm39) missense probably damaging 1.00
R5818:Lmtk2 UTSW 5 144,093,718 (GRCm39) missense probably benign 0.07
R5984:Lmtk2 UTSW 5 144,111,656 (GRCm39) missense probably benign
R6083:Lmtk2 UTSW 5 144,119,574 (GRCm39) missense probably damaging 1.00
R6180:Lmtk2 UTSW 5 144,112,160 (GRCm39) missense probably damaging 1.00
R6411:Lmtk2 UTSW 5 144,111,404 (GRCm39) missense probably damaging 0.99
R6544:Lmtk2 UTSW 5 144,110,624 (GRCm39) missense possibly damaging 0.68
R6628:Lmtk2 UTSW 5 144,111,503 (GRCm39) missense probably benign 0.03
R6698:Lmtk2 UTSW 5 144,111,737 (GRCm39) missense probably benign 0.02
R6742:Lmtk2 UTSW 5 144,085,175 (GRCm39) missense probably damaging 1.00
R6763:Lmtk2 UTSW 5 144,110,615 (GRCm39) missense probably damaging 1.00
R7286:Lmtk2 UTSW 5 144,111,178 (GRCm39) nonsense probably null
R7594:Lmtk2 UTSW 5 144,110,564 (GRCm39) missense probably damaging 1.00
R7660:Lmtk2 UTSW 5 144,085,158 (GRCm39) missense probably damaging 1.00
R7785:Lmtk2 UTSW 5 144,111,571 (GRCm39) missense probably benign 0.00
R7977:Lmtk2 UTSW 5 144,111,959 (GRCm39) missense probably benign 0.02
R7987:Lmtk2 UTSW 5 144,111,959 (GRCm39) missense probably benign 0.02
R8089:Lmtk2 UTSW 5 144,093,718 (GRCm39) missense probably benign 0.07
R8138:Lmtk2 UTSW 5 144,112,415 (GRCm39) missense probably damaging 0.99
R8694:Lmtk2 UTSW 5 144,108,566 (GRCm39) missense probably damaging 1.00
R8714:Lmtk2 UTSW 5 144,112,876 (GRCm39) missense probably damaging 1.00
R8816:Lmtk2 UTSW 5 144,112,793 (GRCm39) nonsense probably null
R8845:Lmtk2 UTSW 5 144,110,704 (GRCm39) missense probably damaging 1.00
R8856:Lmtk2 UTSW 5 144,113,079 (GRCm39) missense probably damaging 1.00
R9306:Lmtk2 UTSW 5 144,119,599 (GRCm39) missense probably benign 0.17
R9494:Lmtk2 UTSW 5 144,037,338 (GRCm39) start gained probably benign
X0024:Lmtk2 UTSW 5 144,111,068 (GRCm39) missense probably benign 0.22
Z1088:Lmtk2 UTSW 5 144,119,669 (GRCm39) missense probably benign 0.12
Predicted Primers PCR Primer
(F):5'- GATCCATTCATATCCAGAATGTTGG -3'
(R):5'- TCCCAAGAGAATGTGGTCGAC -3'

Sequencing Primer
(F):5'- CATTCATATCCAGAATGTTGGTTCAG -3'
(R):5'- TACTTGCCTTGTACAATGAGGAGGAC -3'
Posted On 2019-09-13