Incidental Mutation 'R7390:Amotl2'
ID573370
Institutional Source Beutler Lab
Gene Symbol Amotl2
Ensembl Gene ENSMUSG00000032531
Gene Nameangiomotin-like 2
SynonymsLccp, MASCOT
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.186) question?
Stock #R7390 (G1)
Quality Score225.009
Status Validated
Chromosome9
Chromosomal Location102716672-102733418 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 102731690 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glutamic Acid at position 801 (V801E)
Ref Sequence ENSEMBL: ENSMUSP00000121113 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035121] [ENSMUST00000142011] [ENSMUST00000153965] [ENSMUST00000190047]
Predicted Effect probably damaging
Transcript: ENSMUST00000035121
AA Change: V768E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000035121
Gene: ENSMUSG00000032531
AA Change: V768E

DomainStartEndE-ValueType
low complexity region 33 53 N/A INTRINSIC
low complexity region 72 83 N/A INTRINSIC
low complexity region 157 170 N/A INTRINSIC
low complexity region 192 215 N/A INTRINSIC
low complexity region 248 268 N/A INTRINSIC
Blast:PAC 352 393 1e-12 BLAST
low complexity region 422 436 N/A INTRINSIC
Pfam:Angiomotin_C 478 688 2.3e-98 PFAM
low complexity region 698 710 N/A INTRINSIC
Predicted Effect
SMART Domains Protein: ENSMUSP00000115845
Gene: ENSMUSG00000032531
AA Change: V582E

DomainStartEndE-ValueType
low complexity region 30 50 N/A INTRINSIC
Blast:PAC 134 175 8e-13 BLAST
low complexity region 204 218 N/A INTRINSIC
Pfam:Angiomotin_C 260 470 4.9e-98 PFAM
low complexity region 480 492 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000142011
SMART Domains Protein: ENSMUSP00000120378
Gene: ENSMUSG00000032531

DomainStartEndE-ValueType
low complexity region 33 53 N/A INTRINSIC
low complexity region 72 83 N/A INTRINSIC
low complexity region 157 170 N/A INTRINSIC
low complexity region 192 215 N/A INTRINSIC
low complexity region 248 268 N/A INTRINSIC
Blast:PAC 352 393 1e-12 BLAST
low complexity region 422 436 N/A INTRINSIC
Pfam:Angiomotin_C 478 686 1.2e-94 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000153965
AA Change: V801E

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000121113
Gene: ENSMUSG00000032531
AA Change: V801E

DomainStartEndE-ValueType
low complexity region 66 86 N/A INTRINSIC
low complexity region 105 116 N/A INTRINSIC
low complexity region 190 203 N/A INTRINSIC
low complexity region 225 248 N/A INTRINSIC
low complexity region 281 301 N/A INTRINSIC
Blast:PAC 385 426 1e-12 BLAST
low complexity region 455 469 N/A INTRINSIC
Pfam:Angiomotin_C 511 719 3.7e-94 PFAM
low complexity region 731 743 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000190047
SMART Domains Protein: ENSMUSP00000140688
Gene: ENSMUSG00000032531

DomainStartEndE-ValueType
coiled coil region 1 114 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 97% (66/68)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Angiomotin is a protein that binds angiostatin, a circulating inhibitor of the formation of new blood vessels (angiogenesis). Angiomotin mediates angiostatin inhibition of endothelial cell migration and tube formation in vitro. The protein encoded by this gene is related to angiomotin and is a member of the motin protein family. Alternative splicing results in multiple transcript variants of this gene. [provided by RefSeq, Jul 2013]
PHENOTYPE: Conditional homozygous knockout in endothelial cells during embryonic development leads to aortic restriction in the embryo. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1190002N15Rik A G 9: 94,537,383 S165P probably damaging Het
4930486L24Rik A T 13: 60,844,338 D291E probably benign Het
Abca9 C T 11: 110,145,661 V541I probably benign Het
Adamts15 A T 9: 30,911,108 probably null Het
Adgrg7 A G 16: 56,732,844 I630T probably damaging Het
Ahnak A G 19: 9,003,205 I618V probably benign Het
Ankrd17 T C 5: 90,282,920 T1002A probably benign Het
Bmp7 C T 2: 172,870,205 D409N probably damaging Het
Bpifb2 A G 2: 153,889,806 N293S possibly damaging Het
Ccdc162 A G 10: 41,634,048 C854R probably benign Het
Ccdc171 A G 4: 83,818,067 E1225G probably damaging Het
Cep350 T C 1: 155,866,087 E2146G possibly damaging Het
Ces1a A C 8: 93,044,841 probably null Het
Cfap45 T G 1: 172,541,358 D444E probably benign Het
Cfap61 T C 2: 146,001,882 V296A probably benign Het
Cgnl1 C T 9: 71,645,649 R1011H probably benign Het
Cops4 C T 5: 100,543,875 R347C probably damaging Het
D16Ertd472e G T 16: 78,547,688 D177E probably benign Het
Dcdc2a T C 13: 25,107,617 V195A possibly damaging Het
Dpagt1 G A 9: 44,332,022 V285I probably benign Het
Dspp G T 5: 104,175,686 A232S probably damaging Het
Ephx2 G A 14: 66,110,455 Het
Fat1 T C 8: 44,952,474 V754A possibly damaging Het
Fstl3 G A 10: 79,780,031 C117Y probably damaging Het
Gldc A T 19: 30,099,914 S953T possibly damaging Het
Gm1123 T C 9: 99,010,980 N315S probably benign Het
Gm11639 T C 11: 104,724,585 I726T possibly damaging Het
Golga2 A G 2: 32,288,190 E37G Het
Gpr139 T A 7: 119,144,612 Q250L probably benign Het
Grik3 C T 4: 125,649,739 R283C probably damaging Het
Haao A C 17: 83,846,652 V22G probably damaging Het
Hspg2 T A 4: 137,539,179 F1884I probably damaging Het
Hyal3 G A 9: 107,584,967 G67S probably damaging Het
Kbtbd3 T A 9: 4,330,424 I266K probably benign Het
Klhl26 A C 8: 70,452,849 L137R probably damaging Het
Krt15 A T 11: 100,135,560 V100E possibly damaging Het
Lars A G 18: 42,210,018 probably null Het
Lats1 C T 10: 7,702,095 Q328* probably null Het
Lingo3 G A 10: 80,834,629 T489I probably damaging Het
Lmtk2 T C 5: 144,129,443 V65A possibly damaging Het
Lysmd1 T C 3: 95,138,484 S211P probably damaging Het
Med15 C T 16: 17,722,762 S21N unknown Het
Nav1 T C 1: 135,584,918 T135A probably benign Het
Nt5c1a G C 4: 123,208,479 R66T probably benign Het
Pclo T C 5: 14,682,010 Y3509H unknown Het
Pkp4 G A 2: 59,310,140 G397R possibly damaging Het
Ppp1r21 G A 17: 88,549,530 A138T probably benign Het
Pum3 A T 19: 27,424,242 V136D probably benign Het
Rab11fip3 A T 17: 26,068,152 D342E possibly damaging Het
Rcvrn T A 11: 67,700,057 W156R probably damaging Het
Rspry1 C T 8: 94,623,185 T67I probably benign Het
Serpina1d T C 12: 103,767,778 D89G possibly damaging Het
Sgsm3 T A 15: 81,008,820 V366E possibly damaging Het
Shank3 T G 15: 89,549,312 L1420R probably benign Het
Sirpb1b A T 3: 15,543,040 L215* probably null Het
Slc16a13 C T 11: 70,218,971 V235I probably benign Het
Slc16a14 T C 1: 84,929,466 D29G probably benign Het
Speer1 T C 5: 11,344,912 V122A probably benign Het
Spns2 T A 11: 72,456,878 T329S possibly damaging Het
Sufu G A 19: 46,450,669 probably null Het
Tll2 A G 19: 41,120,169 probably null Het
Trim10 G A 17: 36,869,881 M1I probably null Het
Trim42 A C 9: 97,359,129 N683K probably damaging Het
Trmt5 A G 12: 73,281,620 S270P probably damaging Het
Vmn1r59 C A 7: 5,453,987 R258L possibly damaging Het
Vmn2r32 A G 7: 7,479,852 L41S probably benign Het
Vmn2r93 A T 17: 18,305,067 E329V probably damaging Het
Ywhae G T 11: 75,764,661 E253* probably null Het
Other mutations in Amotl2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02002:Amotl2 APN 9 102725117 missense probably damaging 1.00
IGL02207:Amotl2 APN 9 102724697 missense probably damaging 1.00
R0471:Amotl2 UTSW 9 102720519 missense probably damaging 0.98
R1420:Amotl2 UTSW 9 102724783 missense possibly damaging 0.91
R1483:Amotl2 UTSW 9 102730897 missense probably benign 0.16
R1525:Amotl2 UTSW 9 102728568 missense probably damaging 1.00
R1661:Amotl2 UTSW 9 102730096 missense probably damaging 0.99
R1945:Amotl2 UTSW 9 102720554 missense probably benign
R2113:Amotl2 UTSW 9 102724723 nonsense probably null
R2157:Amotl2 UTSW 9 102730589 unclassified probably benign
R4084:Amotl2 UTSW 9 102724685 critical splice acceptor site probably null
R4726:Amotl2 UTSW 9 102723819 missense probably benign 0.00
R4755:Amotl2 UTSW 9 102720480 missense probably damaging 1.00
R4782:Amotl2 UTSW 9 102720123 critical splice donor site probably null
R4819:Amotl2 UTSW 9 102730071 missense probably damaging 1.00
R5048:Amotl2 UTSW 9 102723798 missense probably benign 0.00
R5328:Amotl2 UTSW 9 102723768 missense probably benign
R5894:Amotl2 UTSW 9 102725172 missense possibly damaging 0.79
R6956:Amotl2 UTSW 9 102724768 missense probably damaging 1.00
R7304:Amotl2 UTSW 9 102728350 missense probably damaging 1.00
R7474:Amotl2 UTSW 9 102730111 missense probably benign 0.00
R7816:Amotl2 UTSW 9 102731654 missense probably benign 0.43
R8017:Amotl2 UTSW 9 102723769 missense probably benign 0.00
R8019:Amotl2 UTSW 9 102723769 missense probably benign 0.00
R8045:Amotl2 UTSW 9 102723769 missense probably benign 0.00
R8046:Amotl2 UTSW 9 102723769 missense probably benign 0.00
X0022:Amotl2 UTSW 9 102729470 missense probably damaging 1.00
Z1088:Amotl2 UTSW 9 102723698 frame shift probably null
Predicted Primers PCR Primer
(F):5'- AAACACAGGCATGGGCTTCC -3'
(R):5'- TGTTTCCTTCAGGCAGGACG -3'

Sequencing Primer
(F):5'- CCTTGTGCTTAGTTGATCAAGGGAAG -3'
(R):5'- TAGGCCAAAAAGCAGTCTTCTAG -3'
Posted On2019-09-13