Mutagenetix > Incidental Mutation

Incidental Mutation 'R7390:Lats1'

573372

Institutional Source

Beutler Lab

Gene Symbol

Lats1

Ensembl Gene

ENSMUSG00000040021

Gene Name

large tumor suppressor

Synonyms

MMRRC Submission

045472-MU

Accession Numbers

Essential gene?

Probably essential (E-score: 0.890) question?

Stock #

R7390 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

7681214-7716460 bp(+) (GRCm38)

Type of Mutation

nonsense

DNA Base Change (assembly)

C to T at 7702095 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glutamine to Stop codon at position 328 (Q328*)

Ref Sequence

ENSEMBL: ENSMUSP00000132078 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000040043] [ENSMUST00000165952] [ENSMUST00000217931]

AlphaFold

Q8BYR2

Predicted Effect

probably null
Transcript: ENSMUST00000040043
AA Change: Q328*

SMART Domains

Protein: ENSMUSP00000041915
Gene: ENSMUSG00000040021
AA Change: Q328*

Domain	Start	End	E-Value	Type
Pfam:UBA	101	138	7.4e-11	PFAM
low complexity region	228	267	N/A	INTRINSIC
low complexity region	301	314	N/A	INTRINSIC
low complexity region	371	379	N/A	INTRINSIC
low complexity region	433	445	N/A	INTRINSIC
low complexity region	482	493	N/A	INTRINSIC
low complexity region	520	530	N/A	INTRINSIC
low complexity region	554	559	N/A	INTRINSIC
S_TKc	704	1009	7.3e-99	SMART
S_TK_X	1010	1081	1.2e-2	SMART
low complexity region	1102	1120	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000165952
AA Change: Q328*

SMART Domains

Protein: ENSMUSP00000132078
Gene: ENSMUSG00000040021
AA Change: Q328*

Domain	Start	End	E-Value	Type
Pfam:UBA	101	138	7.4e-11	PFAM
low complexity region	228	267	N/A	INTRINSIC
low complexity region	301	314	N/A	INTRINSIC
low complexity region	371	379	N/A	INTRINSIC
low complexity region	433	445	N/A	INTRINSIC
low complexity region	482	493	N/A	INTRINSIC
low complexity region	520	530	N/A	INTRINSIC
low complexity region	554	559	N/A	INTRINSIC
S_TKc	704	1009	7.3e-99	SMART
S_TK_X	1010	1081	1.2e-2	SMART
low complexity region	1102	1120	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000217931
AA Change: Q328*

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 99.0%

Validation Efficiency

97% (66/68)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a putative serine/threonine kinase that localizes to the mitotic apparatus and complexes with cell cycle controller CDC2 kinase in early mitosis. The protein is phosphorylated in a cell-cycle dependent manner, with late prophase phosphorylation remaining through metaphase. The N-terminal region of the protein binds CDC2 to form a complex showing reduced H1 histone kinase activity, indicating a role as a negative regulator of CDC2/cyclin A. In addition, the C-terminal kinase domain binds to its own N-terminal region, suggesting potential negative regulation through interference with complex formation via intramolecular binding. Biochemical and genetic data suggest a role as a tumor suppressor. This is supported by studies in knockout mice showing development of soft-tissue sarcomas, ovarian stromal cell tumors and a high sensitivity to carcinogenic treatments. Two protein-coding transcripts and one non-protein coding transcript have been found for this gene. [provided by RefSeq, Jul 2012]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit high postnatal mortality, lack of mammary development, infertility, pituitary hyperplasia, reduced hormone levels, growth retardation, and susceptibility to sarcomas and ovarian stromal cell tumors. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 68 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1190002N15Rik	A	G	9: 94,537,383	S165P	probably damaging	Het
4930486L24Rik	A	T	13: 60,844,338	D291E	probably benign	Het
Abca9	C	T	11: 110,145,661	V541I	probably benign	Het
Adamts15	A	T	9: 30,911,108		probably null	Het
Adgrg7	A	G	16: 56,732,844	I630T	probably damaging	Het
Ahnak	A	G	19: 9,003,205	I618V	probably benign	Het
Amotl2	T	A	9: 102,731,690	V801E	probably damaging	Het
Ankrd17	T	C	5: 90,282,920	T1002A	probably benign	Het
Bmp7	C	T	2: 172,870,205	D409N	probably damaging	Het
Bpifb2	A	G	2: 153,889,806	N293S	possibly damaging	Het
Ccdc162	A	G	10: 41,634,048	C854R	probably benign	Het
Ccdc171	A	G	4: 83,818,067	E1225G	probably damaging	Het
Cep350	T	C	1: 155,866,087	E2146G	possibly damaging	Het
Ces1a	A	C	8: 93,044,841		probably null	Het
Cfap45	T	G	1: 172,541,358	D444E	probably benign	Het
Cfap61	T	C	2: 146,001,882	V296A	probably benign	Het
Cgnl1	C	T	9: 71,645,649	R1011H	probably benign	Het
Cops4	C	T	5: 100,543,875	R347C	probably damaging	Het
D16Ertd472e	G	T	16: 78,547,688	D177E	probably benign	Het
Dcdc2a	T	C	13: 25,107,617	V195A	possibly damaging	Het
Dpagt1	G	A	9: 44,332,022	V285I	probably benign	Het
Dspp	G	T	5: 104,175,686	A232S	probably damaging	Het
Ephx2	G	A	14: 66,110,455			Het
Fat1	T	C	8: 44,952,474	V754A	possibly damaging	Het
Fstl3	G	A	10: 79,780,031	C117Y	probably damaging	Het
Gldc	A	T	19: 30,099,914	S953T	possibly damaging	Het
Gm1123	T	C	9: 99,010,980	N315S	probably benign	Het
Gm11639	T	C	11: 104,724,585	I726T	possibly damaging	Het
Golga2	A	G	2: 32,288,190	E37G		Het
Gpr139	T	A	7: 119,144,612	Q250L	probably benign	Het
Grik3	C	T	4: 125,649,739	R283C	probably damaging	Het
Haao	A	C	17: 83,846,652	V22G	probably damaging	Het
Hspg2	T	A	4: 137,539,179	F1884I	probably damaging	Het
Hyal3	G	A	9: 107,584,967	G67S	probably damaging	Het
Kbtbd3	T	A	9: 4,330,424	I266K	probably benign	Het
Klhl26	A	C	8: 70,452,849	L137R	probably damaging	Het
Krt15	A	T	11: 100,135,560	V100E	possibly damaging	Het
Lars	A	G	18: 42,210,018		probably null	Het
Lingo3	G	A	10: 80,834,629	T489I	probably damaging	Het
Lmtk2	T	C	5: 144,129,443	V65A	possibly damaging	Het
Lysmd1	T	C	3: 95,138,484	S211P	probably damaging	Het
Med15	C	T	16: 17,722,762	S21N	unknown	Het
Nav1	T	C	1: 135,584,918	T135A	probably benign	Het
Nt5c1a	G	C	4: 123,208,479	R66T	probably benign	Het
Pclo	T	C	5: 14,682,010	Y3509H	unknown	Het
Pkp4	G	A	2: 59,310,140	G397R	possibly damaging	Het
Ppp1r21	G	A	17: 88,549,530	A138T	probably benign	Het
Pum3	A	T	19: 27,424,242	V136D	probably benign	Het
Rab11fip3	A	T	17: 26,068,152	D342E	possibly damaging	Het
Rcvrn	T	A	11: 67,700,057	W156R	probably damaging	Het
Rspry1	C	T	8: 94,623,185	T67I	probably benign	Het
Serpina1d	T	C	12: 103,767,778	D89G	possibly damaging	Het
Sgsm3	T	A	15: 81,008,820	V366E	possibly damaging	Het
Shank3	T	G	15: 89,549,312	L1420R	probably benign	Het
Sirpb1b	A	T	3: 15,543,040	L215*	probably null	Het
Slc16a13	C	T	11: 70,218,971	V235I	probably benign	Het
Slc16a14	T	C	1: 84,929,466	D29G	probably benign	Het
Speer1	T	C	5: 11,344,912	V122A	probably benign	Het
Spns2	T	A	11: 72,456,878	T329S	possibly damaging	Het
Sufu	G	A	19: 46,450,669		probably null	Het
Tll2	A	G	19: 41,120,169		probably null	Het
Trim10	G	A	17: 36,869,881	M1I	probably null	Het
Trim42	A	C	9: 97,359,129	N683K	probably damaging	Het
Trmt5	A	G	12: 73,281,620	S270P	probably damaging	Het
Vmn1r59	C	A	7: 5,453,987	R258L	possibly damaging	Het
Vmn2r32	A	G	7: 7,479,852	L41S	probably benign	Het
Vmn2r93	A	T	17: 18,305,067	E329V	probably damaging	Het
Ywhae	G	T	11: 75,764,661	E253*	probably null	Het

Other mutations in Lats1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00234:Lats1	APN	10	7691566	missense	probably damaging	0.99
IGL00595:Lats1	APN	10	7702305	missense	probably benign	0.00
IGL00932:Lats1	APN	10	7712742	missense	possibly damaging	0.69
IGL01019:Lats1	APN	10	7705671	missense	probably damaging	1.00
IGL01380:Lats1	APN	10	7691780	missense	possibly damaging	0.69
IGL01965:Lats1	APN	10	7701706	missense	probably benign	0.10
IGL02027:Lats1	APN	10	7712948	missense	probably benign
IGL02611:Lats1	APN	10	7705787	missense	possibly damaging	0.91
IGL02997:Lats1	APN	10	7702254	missense	possibly damaging	0.53
IGL03107:Lats1	APN	10	7712746	missense	probably benign	0.15
I1329:Lats1	UTSW	10	7712802	missense	probably benign	0.10
PIT4378001:Lats1	UTSW	10	7705605	missense	probably damaging	1.00
R0153:Lats1	UTSW	10	7691575	missense	probably damaging	1.00
R0568:Lats1	UTSW	10	7712528	missense	possibly damaging	0.69
R0581:Lats1	UTSW	10	7702941	missense	possibly damaging	0.67
R0604:Lats1	UTSW	10	7712661	missense	probably damaging	0.96
R1681:Lats1	UTSW	10	7705914	missense	probably damaging	0.99
R1694:Lats1	UTSW	10	7701945	missense	probably benign	0.07
R1840:Lats1	UTSW	10	7710939	nonsense	probably null
R1914:Lats1	UTSW	10	7710457	splice site	probably benign
R2137:Lats1	UTSW	10	7701847	missense	possibly damaging	0.71
R2317:Lats1	UTSW	10	7691776	nonsense	probably null
R3863:Lats1	UTSW	10	7705746	missense	probably damaging	1.00
R3864:Lats1	UTSW	10	7705746	missense	probably damaging	1.00
R4597:Lats1	UTSW	10	7691746	missense	probably benign	0.00
R4657:Lats1	UTSW	10	7705684	missense	possibly damaging	0.82
R4658:Lats1	UTSW	10	7702729	missense	probably benign
R4663:Lats1	UTSW	10	7712583	missense	probably damaging	1.00
R4870:Lats1	UTSW	10	7705785	missense	probably damaging	1.00
R5101:Lats1	UTSW	10	7712584	nonsense	probably null
R5134:Lats1	UTSW	10	7691811	missense	probably benign	0.34
R5150:Lats1	UTSW	10	7712651	missense	probably benign
R5546:Lats1	UTSW	10	7705754	missense	probably damaging	0.99
R5820:Lats1	UTSW	10	7705908	missense	probably damaging	1.00
R6006:Lats1	UTSW	10	7705595	missense	probably damaging	1.00
R6301:Lats1	UTSW	10	7703107	missense	probably benign	0.01
R6544:Lats1	UTSW	10	7701670	missense	possibly damaging	0.94
R6647:Lats1	UTSW	10	7697507	missense	possibly damaging	0.81
R6874:Lats1	UTSW	10	7710851	missense	probably damaging	1.00
R7328:Lats1	UTSW	10	7705547	missense	possibly damaging	0.62
R7438:Lats1	UTSW	10	7712942	nonsense	probably null
R7457:Lats1	UTSW	10	7710891	missense	probably damaging	1.00
R7524:Lats1	UTSW	10	7701978	missense	possibly damaging	0.89
R7593:Lats1	UTSW	10	7701712	missense	probably damaging	1.00
R7736:Lats1	UTSW	10	7702364	missense	probably damaging	1.00
R7884:Lats1	UTSW	10	7697526	nonsense	probably null
R8166:Lats1	UTSW	10	7702116	missense	probably benign
R8248:Lats1	UTSW	10	7705903	missense	probably damaging	1.00
R8458:Lats1	UTSW	10	7710924	nonsense	probably null
R8477:Lats1	UTSW	10	7705515	missense	probably damaging	1.00
R8547:Lats1	UTSW	10	7712849	missense	probably damaging	1.00
R9163:Lats1	UTSW	10	7702288	missense	probably benign
R9441:Lats1	UTSW	10	7702917	missense	probably damaging	0.96
R9673:Lats1	UTSW	10	7712623	missense	probably benign	0.29
RF021:Lats1	UTSW	10	7710608	missense	probably damaging	1.00
X0026:Lats1	UTSW	10	7710623	missense	probably damaging	1.00
X0053:Lats1	UTSW	10	7691609	missense	probably benign	0.00
Z1176:Lats1	UTSW	10	7705809	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GCTCTCAGACAAAGCGCTACTC -3'
(R):5'- GAACGTTTCCATTGGCGAATG -3'

Sequencing Primer
(F):5'- TCTGGGAACATGGAGTACGTAATCTC -3'
(R):5'- AGCCCCTGTTTGTAAAGCAG -3'

Posted On

2019-09-13