Incidental Mutation 'R7390:Slc16a13'
ID573377
Institutional Source Beutler Lab
Gene Symbol Slc16a13
Ensembl Gene ENSMUSG00000044367
Gene Namesolute carrier family 16 (monocarboxylic acid transporters), member 13
Synonyms1700007D07Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.378) question?
Stock #R7390 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location70216789-70221064 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 70218971 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 235 (V235I)
Ref Sequence ENSEMBL: ENSMUSP00000053218 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000060010] [ENSMUST00000094055] [ENSMUST00000123716] [ENSMUST00000126296] [ENSMUST00000126388] [ENSMUST00000136328] [ENSMUST00000141290] [ENSMUST00000153993] [ENSMUST00000159867] [ENSMUST00000171032] [ENSMUST00000190533]
Predicted Effect probably benign
Transcript: ENSMUST00000060010
AA Change: V235I

PolyPhen 2 Score 0.029 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000053218
Gene: ENSMUSG00000044367
AA Change: V235I

DomainStartEndE-ValueType
Pfam:MFS_1 14 277 1.7e-22 PFAM
Pfam:MFS_1 219 423 6.8e-14 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000094055
SMART Domains Protein: ENSMUSP00000091597
Gene: ENSMUSG00000040938

DomainStartEndE-ValueType
Pfam:MFS_1 17 340 5.5e-24 PFAM
transmembrane domain 343 365 N/A INTRINSIC
transmembrane domain 380 402 N/A INTRINSIC
low complexity region 407 420 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000123716
SMART Domains Protein: ENSMUSP00000114871
Gene: ENSMUSG00000040938

DomainStartEndE-ValueType
transmembrane domain 15 37 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000126296
SMART Domains Protein: ENSMUSP00000118381
Gene: ENSMUSG00000040938

DomainStartEndE-ValueType
Pfam:MFS_1 16 196 2e-20 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000126388
SMART Domains Protein: ENSMUSP00000116648
Gene: ENSMUSG00000040938

DomainStartEndE-ValueType
Pfam:MFS_1 17 340 5.5e-24 PFAM
transmembrane domain 343 365 N/A INTRINSIC
transmembrane domain 380 402 N/A INTRINSIC
low complexity region 407 420 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000136328
SMART Domains Protein: ENSMUSP00000115212
Gene: ENSMUSG00000040938

DomainStartEndE-ValueType
transmembrane domain 15 37 N/A INTRINSIC
Pfam:MFS_1 66 297 8.3e-10 PFAM
low complexity region 306 324 N/A INTRINSIC
transmembrane domain 332 354 N/A INTRINSIC
low complexity region 359 372 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000141290
SMART Domains Protein: ENSMUSP00000116316
Gene: ENSMUSG00000044367

DomainStartEndE-ValueType
transmembrane domain 10 32 N/A INTRINSIC
transmembrane domain 52 74 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000153993
SMART Domains Protein: ENSMUSP00000122586
Gene: ENSMUSG00000040938

DomainStartEndE-ValueType
transmembrane domain 15 37 N/A INTRINSIC
low complexity region 56 68 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000159867
SMART Domains Protein: ENSMUSP00000124687
Gene: ENSMUSG00000044367

DomainStartEndE-ValueType
transmembrane domain 20 42 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000171032
SMART Domains Protein: ENSMUSP00000128419
Gene: ENSMUSG00000040938

DomainStartEndE-ValueType
Pfam:MFS_1 17 316 1.8e-24 PFAM
transmembrane domain 343 365 N/A INTRINSIC
transmembrane domain 380 402 N/A INTRINSIC
low complexity region 407 420 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000190533
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 97% (66/68)
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1190002N15Rik A G 9: 94,537,383 S165P probably damaging Het
4930486L24Rik A T 13: 60,844,338 D291E probably benign Het
Abca9 C T 11: 110,145,661 V541I probably benign Het
Adamts15 A T 9: 30,911,108 probably null Het
Adgrg7 A G 16: 56,732,844 I630T probably damaging Het
Ahnak A G 19: 9,003,205 I618V probably benign Het
Amotl2 T A 9: 102,731,690 V801E probably damaging Het
Ankrd17 T C 5: 90,282,920 T1002A probably benign Het
Bmp7 C T 2: 172,870,205 D409N probably damaging Het
Bpifb2 A G 2: 153,889,806 N293S possibly damaging Het
Ccdc162 A G 10: 41,634,048 C854R probably benign Het
Ccdc171 A G 4: 83,818,067 E1225G probably damaging Het
Cep350 T C 1: 155,866,087 E2146G possibly damaging Het
Ces1a A C 8: 93,044,841 probably null Het
Cfap45 T G 1: 172,541,358 D444E probably benign Het
Cfap61 T C 2: 146,001,882 V296A probably benign Het
Cgnl1 C T 9: 71,645,649 R1011H probably benign Het
Cops4 C T 5: 100,543,875 R347C probably damaging Het
D16Ertd472e G T 16: 78,547,688 D177E probably benign Het
Dcdc2a T C 13: 25,107,617 V195A possibly damaging Het
Dpagt1 G A 9: 44,332,022 V285I probably benign Het
Dspp G T 5: 104,175,686 A232S probably damaging Het
Ephx2 G A 14: 66,110,455 Het
Fat1 T C 8: 44,952,474 V754A possibly damaging Het
Fstl3 G A 10: 79,780,031 C117Y probably damaging Het
Gldc A T 19: 30,099,914 S953T possibly damaging Het
Gm1123 T C 9: 99,010,980 N315S probably benign Het
Gm11639 T C 11: 104,724,585 I726T possibly damaging Het
Golga2 A G 2: 32,288,190 E37G Het
Gpr139 T A 7: 119,144,612 Q250L probably benign Het
Grik3 C T 4: 125,649,739 R283C probably damaging Het
Haao A C 17: 83,846,652 V22G probably damaging Het
Hspg2 T A 4: 137,539,179 F1884I probably damaging Het
Hyal3 G A 9: 107,584,967 G67S probably damaging Het
Kbtbd3 T A 9: 4,330,424 I266K probably benign Het
Klhl26 A C 8: 70,452,849 L137R probably damaging Het
Krt15 A T 11: 100,135,560 V100E possibly damaging Het
Lars A G 18: 42,210,018 probably null Het
Lats1 C T 10: 7,702,095 Q328* probably null Het
Lingo3 G A 10: 80,834,629 T489I probably damaging Het
Lmtk2 T C 5: 144,129,443 V65A possibly damaging Het
Lysmd1 T C 3: 95,138,484 S211P probably damaging Het
Med15 C T 16: 17,722,762 S21N unknown Het
Nav1 T C 1: 135,584,918 T135A probably benign Het
Nt5c1a G C 4: 123,208,479 R66T probably benign Het
Pclo T C 5: 14,682,010 Y3509H unknown Het
Pkp4 G A 2: 59,310,140 G397R possibly damaging Het
Ppp1r21 G A 17: 88,549,530 A138T probably benign Het
Pum3 A T 19: 27,424,242 V136D probably benign Het
Rab11fip3 A T 17: 26,068,152 D342E possibly damaging Het
Rcvrn T A 11: 67,700,057 W156R probably damaging Het
Rspry1 C T 8: 94,623,185 T67I probably benign Het
Serpina1d T C 12: 103,767,778 D89G possibly damaging Het
Sgsm3 T A 15: 81,008,820 V366E possibly damaging Het
Shank3 T G 15: 89,549,312 L1420R probably benign Het
Sirpb1b A T 3: 15,543,040 L215* probably null Het
Slc16a14 T C 1: 84,929,466 D29G probably benign Het
Speer1 T C 5: 11,344,912 V122A probably benign Het
Spns2 T A 11: 72,456,878 T329S possibly damaging Het
Sufu G A 19: 46,450,669 probably null Het
Tll2 A G 19: 41,120,169 probably null Het
Trim10 G A 17: 36,869,881 M1I probably null Het
Trim42 A C 9: 97,359,129 N683K probably damaging Het
Trmt5 A G 12: 73,281,620 S270P probably damaging Het
Vmn1r59 C A 7: 5,453,987 R258L possibly damaging Het
Vmn2r32 A G 7: 7,479,852 L41S probably benign Het
Vmn2r93 A T 17: 18,305,067 E329V probably damaging Het
Ywhae G T 11: 75,764,661 E253* probably null Het
Other mutations in Slc16a13
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01343:Slc16a13 APN 11 70220514 missense probably damaging 0.99
R0729:Slc16a13 UTSW 11 70219031 missense probably damaging 1.00
R0792:Slc16a13 UTSW 11 70220631 missense probably damaging 1.00
R1086:Slc16a13 UTSW 11 70219024 missense probably damaging 1.00
R1588:Slc16a13 UTSW 11 70218595 nonsense probably null
R1593:Slc16a13 UTSW 11 70219082 missense probably benign 0.04
R4329:Slc16a13 UTSW 11 70217897 missense probably benign 0.03
R4688:Slc16a13 UTSW 11 70220275 missense probably damaging 0.98
R6846:Slc16a13 UTSW 11 70217835 missense probably benign 0.35
R7380:Slc16a13 UTSW 11 70219279 missense probably damaging 1.00
R7514:Slc16a13 UTSW 11 70218884 missense probably damaging 0.96
R7807:Slc16a13 UTSW 11 70220562 missense probably damaging 0.97
R7888:Slc16a13 UTSW 11 70218980 missense possibly damaging 0.79
R7971:Slc16a13 UTSW 11 70218980 missense possibly damaging 0.79
Predicted Primers PCR Primer
(F):5'- GAAACAGGGCTAGTGACACC -3'
(R):5'- TCAACAACTATGCCTGGAGAGG -3'

Sequencing Primer
(F):5'- GGCTAGTGACACCCCAGTC -3'
(R):5'- GGGCCCTCTTGCTAGTGTC -3'
Posted On2019-09-13