Incidental Mutation 'R7390:Spns2'
ID573378
Institutional Source Beutler Lab
Gene Symbol Spns2
Ensembl Gene ENSMUSG00000040447
Gene Namespinster homolog 2
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7390 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location72451638-72489904 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 72456878 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Serine at position 329 (T329S)
Ref Sequence ENSEMBL: ENSMUSP00000044418 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045303]
Predicted Effect possibly damaging
Transcript: ENSMUST00000045303
AA Change: T329S

PolyPhen 2 Score 0.814 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000044418
Gene: ENSMUSG00000040447
AA Change: T329S

DomainStartEndE-ValueType
low complexity region 5 53 N/A INTRINSIC
Pfam:Sugar_tr 104 308 7.6e-16 PFAM
Pfam:OATP 106 427 7.2e-13 PFAM
Pfam:MFS_1 108 476 2.7e-37 PFAM
transmembrane domain 506 528 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000144940
SMART Domains Protein: ENSMUSP00000120722
Gene: ENSMUSG00000040447

DomainStartEndE-ValueType
transmembrane domain 13 32 N/A INTRINSIC
transmembrane domain 37 59 N/A INTRINSIC
transmembrane domain 80 102 N/A INTRINSIC
Meta Mutation Damage Score 0.1929 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 97% (66/68)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a transporter of sphingosine 1-phosphate, a secreted lipid that is important in cardiovascular, immunological, and neural development. Defects in this gene are a cause of early onset progressive hearing loss. [provided by RefSeq, Jul 2016]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit symblepharon and impaired egress of T and B cells from the thymus and bone marrow, respectively. Mice homozygous for a different knock-out allele exhibit abnormal immune system, abnormal eye morphology and absent pinna reflex. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1190002N15Rik A G 9: 94,537,383 S165P probably damaging Het
4930486L24Rik A T 13: 60,844,338 D291E probably benign Het
Abca9 C T 11: 110,145,661 V541I probably benign Het
Adamts15 A T 9: 30,911,108 probably null Het
Adgrg7 A G 16: 56,732,844 I630T probably damaging Het
Ahnak A G 19: 9,003,205 I618V probably benign Het
Amotl2 T A 9: 102,731,690 V801E probably damaging Het
Ankrd17 T C 5: 90,282,920 T1002A probably benign Het
Bmp7 C T 2: 172,870,205 D409N probably damaging Het
Bpifb2 A G 2: 153,889,806 N293S possibly damaging Het
Ccdc162 A G 10: 41,634,048 C854R probably benign Het
Ccdc171 A G 4: 83,818,067 E1225G probably damaging Het
Cep350 T C 1: 155,866,087 E2146G possibly damaging Het
Ces1a A C 8: 93,044,841 probably null Het
Cfap45 T G 1: 172,541,358 D444E probably benign Het
Cfap61 T C 2: 146,001,882 V296A probably benign Het
Cgnl1 C T 9: 71,645,649 R1011H probably benign Het
Cops4 C T 5: 100,543,875 R347C probably damaging Het
D16Ertd472e G T 16: 78,547,688 D177E probably benign Het
Dcdc2a T C 13: 25,107,617 V195A possibly damaging Het
Dpagt1 G A 9: 44,332,022 V285I probably benign Het
Dspp G T 5: 104,175,686 A232S probably damaging Het
Ephx2 G A 14: 66,110,455 Het
Fat1 T C 8: 44,952,474 V754A possibly damaging Het
Fstl3 G A 10: 79,780,031 C117Y probably damaging Het
Gldc A T 19: 30,099,914 S953T possibly damaging Het
Gm1123 T C 9: 99,010,980 N315S probably benign Het
Gm11639 T C 11: 104,724,585 I726T possibly damaging Het
Golga2 A G 2: 32,288,190 E37G Het
Gpr139 T A 7: 119,144,612 Q250L probably benign Het
Grik3 C T 4: 125,649,739 R283C probably damaging Het
Haao A C 17: 83,846,652 V22G probably damaging Het
Hspg2 T A 4: 137,539,179 F1884I probably damaging Het
Hyal3 G A 9: 107,584,967 G67S probably damaging Het
Kbtbd3 T A 9: 4,330,424 I266K probably benign Het
Klhl26 A C 8: 70,452,849 L137R probably damaging Het
Krt15 A T 11: 100,135,560 V100E possibly damaging Het
Lars A G 18: 42,210,018 probably null Het
Lats1 C T 10: 7,702,095 Q328* probably null Het
Lingo3 G A 10: 80,834,629 T489I probably damaging Het
Lmtk2 T C 5: 144,129,443 V65A possibly damaging Het
Lysmd1 T C 3: 95,138,484 S211P probably damaging Het
Med15 C T 16: 17,722,762 S21N unknown Het
Nav1 T C 1: 135,584,918 T135A probably benign Het
Nt5c1a G C 4: 123,208,479 R66T probably benign Het
Pclo T C 5: 14,682,010 Y3509H unknown Het
Pkp4 G A 2: 59,310,140 G397R possibly damaging Het
Ppp1r21 G A 17: 88,549,530 A138T probably benign Het
Pum3 A T 19: 27,424,242 V136D probably benign Het
Rab11fip3 A T 17: 26,068,152 D342E possibly damaging Het
Rcvrn T A 11: 67,700,057 W156R probably damaging Het
Rspry1 C T 8: 94,623,185 T67I probably benign Het
Serpina1d T C 12: 103,767,778 D89G possibly damaging Het
Sgsm3 T A 15: 81,008,820 V366E possibly damaging Het
Shank3 T G 15: 89,549,312 L1420R probably benign Het
Sirpb1b A T 3: 15,543,040 L215* probably null Het
Slc16a13 C T 11: 70,218,971 V235I probably benign Het
Slc16a14 T C 1: 84,929,466 D29G probably benign Het
Speer1 T C 5: 11,344,912 V122A probably benign Het
Sufu G A 19: 46,450,669 probably null Het
Tll2 A G 19: 41,120,169 probably null Het
Trim10 G A 17: 36,869,881 M1I probably null Het
Trim42 A C 9: 97,359,129 N683K probably damaging Het
Trmt5 A G 12: 73,281,620 S270P probably damaging Het
Vmn1r59 C A 7: 5,453,987 R258L possibly damaging Het
Vmn2r32 A G 7: 7,479,852 L41S probably benign Het
Vmn2r93 A T 17: 18,305,067 E329V probably damaging Het
Ywhae G T 11: 75,764,661 E253* probably null Het
Other mutations in Spns2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01733:Spns2 APN 11 72456510 missense possibly damaging 0.79
IGL01804:Spns2 APN 11 72457304 missense possibly damaging 0.89
elderly UTSW 11 72456370 critical splice acceptor site probably null
homely UTSW 11 72456860 missense probably damaging 1.00
whistler UTSW 11 72458687 nonsense probably null
wrinkled UTSW 11 72456878 missense possibly damaging 0.81
R0883:Spns2 UTSW 11 72454397 missense probably damaging 1.00
R1544:Spns2 UTSW 11 72456367 missense probably benign 0.30
R1696:Spns2 UTSW 11 72456347 missense probably benign 0.25
R2046:Spns2 UTSW 11 72459040 missense possibly damaging 0.49
R2164:Spns2 UTSW 11 72458671 missense possibly damaging 0.82
R2259:Spns2 UTSW 11 72457268 missense probably benign 0.35
R4209:Spns2 UTSW 11 72454186 missense probably benign 0.07
R5285:Spns2 UTSW 11 72489479 missense possibly damaging 0.92
R6883:Spns2 UTSW 11 72456370 critical splice acceptor site probably null
R6990:Spns2 UTSW 11 72489621 missense probably benign 0.08
R7221:Spns2 UTSW 11 72456916 missense probably benign 0.43
R7227:Spns2 UTSW 11 72458687 nonsense probably null
R7243:Spns2 UTSW 11 72456860 missense probably damaging 1.00
R7699:Spns2 UTSW 11 72489617 nonsense probably null
R7700:Spns2 UTSW 11 72489617 nonsense probably null
R8042:Spns2 UTSW 11 72454177 missense possibly damaging 0.46
R8155:Spns2 UTSW 11 72456568 missense possibly damaging 0.46
Predicted Primers PCR Primer
(F):5'- AGTAAAGCAGGTAATGGCTCC -3'
(R):5'- GGCCTGAGAAAGCGCATTTC -3'

Sequencing Primer
(F):5'- TGGCTCCAAAGATGAGGCTGTG -3'
(R):5'- AAAGCGCATTTCTGTTTGGGGAAG -3'
Posted On2019-09-13