Incidental Mutation 'R7390:Trmt5'
ID573383
Institutional Source Beutler Lab
Gene Symbol Trmt5
Ensembl Gene ENSMUSG00000034442
Gene NameTRM5 tRNA methyltransferase 5
Synonyms2610027O18Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.954) question?
Stock #R7390 (G1)
Quality Score225.009
Status Validated
Chromosome12
Chromosomal Location73280011-73286710 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 73281620 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 270 (S270P)
Ref Sequence ENSEMBL: ENSMUSP00000112121 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000116420] [ENSMUST00000220701] [ENSMUST00000221189]
Predicted Effect probably damaging
Transcript: ENSMUST00000116420
AA Change: S270P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000112121
Gene: ENSMUSG00000034442
AA Change: S270P

DomainStartEndE-ValueType
Pfam:Met_10 191 412 4.5e-65 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000220701
Predicted Effect probably benign
Transcript: ENSMUST00000221189
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 97% (66/68)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] tRNAs contain as many as 13 or 14 nucleotides that are modified posttranscriptionally by enzymes that are highly specific for particular nucleotides in the tRNA structure. TRMT5 methylates the N1 position of guanosine-37 (G37) in selected tRNAs using S-adenosyl methionine (Brule et al., 2004 [PubMed 15248782]).[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1190002N15Rik A G 9: 94,537,383 S165P probably damaging Het
4930486L24Rik A T 13: 60,844,338 D291E probably benign Het
Abca9 C T 11: 110,145,661 V541I probably benign Het
Adamts15 A T 9: 30,911,108 probably null Het
Adgrg7 A G 16: 56,732,844 I630T probably damaging Het
Ahnak A G 19: 9,003,205 I618V probably benign Het
Amotl2 T A 9: 102,731,690 V801E probably damaging Het
Ankrd17 T C 5: 90,282,920 T1002A probably benign Het
Bmp7 C T 2: 172,870,205 D409N probably damaging Het
Bpifb2 A G 2: 153,889,806 N293S possibly damaging Het
Ccdc162 A G 10: 41,634,048 C854R probably benign Het
Ccdc171 A G 4: 83,818,067 E1225G probably damaging Het
Cep350 T C 1: 155,866,087 E2146G possibly damaging Het
Ces1a A C 8: 93,044,841 probably null Het
Cfap45 T G 1: 172,541,358 D444E probably benign Het
Cfap61 T C 2: 146,001,882 V296A probably benign Het
Cgnl1 C T 9: 71,645,649 R1011H probably benign Het
Cops4 C T 5: 100,543,875 R347C probably damaging Het
D16Ertd472e G T 16: 78,547,688 D177E probably benign Het
Dcdc2a T C 13: 25,107,617 V195A possibly damaging Het
Dpagt1 G A 9: 44,332,022 V285I probably benign Het
Dspp G T 5: 104,175,686 A232S probably damaging Het
Ephx2 G A 14: 66,110,455 Het
Fat1 T C 8: 44,952,474 V754A possibly damaging Het
Fstl3 G A 10: 79,780,031 C117Y probably damaging Het
Gldc A T 19: 30,099,914 S953T possibly damaging Het
Gm1123 T C 9: 99,010,980 N315S probably benign Het
Gm11639 T C 11: 104,724,585 I726T possibly damaging Het
Golga2 A G 2: 32,288,190 E37G Het
Gpr139 T A 7: 119,144,612 Q250L probably benign Het
Grik3 C T 4: 125,649,739 R283C probably damaging Het
Haao A C 17: 83,846,652 V22G probably damaging Het
Hspg2 T A 4: 137,539,179 F1884I probably damaging Het
Hyal3 G A 9: 107,584,967 G67S probably damaging Het
Kbtbd3 T A 9: 4,330,424 I266K probably benign Het
Klhl26 A C 8: 70,452,849 L137R probably damaging Het
Krt15 A T 11: 100,135,560 V100E possibly damaging Het
Lars A G 18: 42,210,018 probably null Het
Lats1 C T 10: 7,702,095 Q328* probably null Het
Lingo3 G A 10: 80,834,629 T489I probably damaging Het
Lmtk2 T C 5: 144,129,443 V65A possibly damaging Het
Lysmd1 T C 3: 95,138,484 S211P probably damaging Het
Med15 C T 16: 17,722,762 S21N unknown Het
Nav1 T C 1: 135,584,918 T135A probably benign Het
Nt5c1a G C 4: 123,208,479 R66T probably benign Het
Pclo T C 5: 14,682,010 Y3509H unknown Het
Pkp4 G A 2: 59,310,140 G397R possibly damaging Het
Ppp1r21 G A 17: 88,549,530 A138T probably benign Het
Pum3 A T 19: 27,424,242 V136D probably benign Het
Rab11fip3 A T 17: 26,068,152 D342E possibly damaging Het
Rcvrn T A 11: 67,700,057 W156R probably damaging Het
Rspry1 C T 8: 94,623,185 T67I probably benign Het
Serpina1d T C 12: 103,767,778 D89G possibly damaging Het
Sgsm3 T A 15: 81,008,820 V366E possibly damaging Het
Shank3 T G 15: 89,549,312 L1420R probably benign Het
Sirpb1b A T 3: 15,543,040 L215* probably null Het
Slc16a13 C T 11: 70,218,971 V235I probably benign Het
Slc16a14 T C 1: 84,929,466 D29G probably benign Het
Speer1 T C 5: 11,344,912 V122A probably benign Het
Spns2 T A 11: 72,456,878 T329S possibly damaging Het
Sufu G A 19: 46,450,669 probably null Het
Tll2 A G 19: 41,120,169 probably null Het
Trim10 G A 17: 36,869,881 M1I probably null Het
Trim42 A C 9: 97,359,129 N683K probably damaging Het
Vmn1r59 C A 7: 5,453,987 R258L possibly damaging Het
Vmn2r32 A G 7: 7,479,852 L41S probably benign Het
Vmn2r93 A T 17: 18,305,067 E329V probably damaging Het
Ywhae G T 11: 75,764,661 E253* probably null Het
Other mutations in Trmt5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00539:Trmt5 APN 12 73284919 missense possibly damaging 0.80
IGL01468:Trmt5 APN 12 73281104 missense probably benign 0.08
IGL01681:Trmt5 APN 12 73282603 unclassified probably benign
IGL02502:Trmt5 APN 12 73281227 missense probably benign 0.06
IGL02627:Trmt5 APN 12 73281455 missense probably damaging 1.00
IGL02688:Trmt5 APN 12 73281458 nonsense probably null
IGL03390:Trmt5 APN 12 73282727 missense probably benign 0.30
IGL03391:Trmt5 APN 12 73281452 missense probably benign 0.00
R2068:Trmt5 UTSW 12 73284670 splice site probably null
R2239:Trmt5 UTSW 12 73285114 missense probably benign 0.00
R2380:Trmt5 UTSW 12 73285114 missense probably benign 0.00
R5169:Trmt5 UTSW 12 73282721 missense probably damaging 1.00
R5578:Trmt5 UTSW 12 73285063 splice site probably null
R5579:Trmt5 UTSW 12 73281652 missense possibly damaging 0.92
R7991:Trmt5 UTSW 12 73282665 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAGTTTACAATTGTGCAACAGC -3'
(R):5'- TGGTCCCAGAAATGGTATAAAGAC -3'

Sequencing Primer
(F):5'- CAATTGTGCAACAGCCATTTATG -3'
(R):5'- CAGTTTCAGTGGACAGAC -3'
Posted On2019-09-13