Incidental Mutation 'R7390:Serpina1d'
ID573384
Institutional Source Beutler Lab
Gene Symbol Serpina1d
Ensembl Gene ENSMUSG00000071177
Gene Nameserine (or cysteine) peptidase inhibitor, clade A, member 1D
SynonymsSpi1-4, PI4
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.084) question?
Stock #R7390 (G1)
Quality Score225.009
Status Validated
Chromosome12
Chromosomal Location103763594-103773592 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 103767778 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 89 (D89G)
Ref Sequence ENSEMBL: ENSMUSP00000077909 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000078869] [ENSMUST00000164454]
Predicted Effect possibly damaging
Transcript: ENSMUST00000078869
AA Change: D89G

PolyPhen 2 Score 0.864 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000077909
Gene: ENSMUSG00000071177
AA Change: D89G

DomainStartEndE-ValueType
low complexity region 9 18 N/A INTRINSIC
SERPIN 53 410 3.17e-200 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000164454
SMART Domains Protein: ENSMUSP00000127266
Gene: ENSMUSG00000071178

DomainStartEndE-ValueType
SERPIN 53 410 7.62e-203 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 97% (66/68)
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1190002N15Rik A G 9: 94,537,383 S165P probably damaging Het
4930486L24Rik A T 13: 60,844,338 D291E probably benign Het
Abca9 C T 11: 110,145,661 V541I probably benign Het
Adamts15 A T 9: 30,911,108 probably null Het
Adgrg7 A G 16: 56,732,844 I630T probably damaging Het
Ahnak A G 19: 9,003,205 I618V probably benign Het
Amotl2 T A 9: 102,731,690 V801E probably damaging Het
Ankrd17 T C 5: 90,282,920 T1002A probably benign Het
Bmp7 C T 2: 172,870,205 D409N probably damaging Het
Bpifb2 A G 2: 153,889,806 N293S possibly damaging Het
Ccdc162 A G 10: 41,634,048 C854R probably benign Het
Ccdc171 A G 4: 83,818,067 E1225G probably damaging Het
Cep350 T C 1: 155,866,087 E2146G possibly damaging Het
Ces1a A C 8: 93,044,841 probably null Het
Cfap45 T G 1: 172,541,358 D444E probably benign Het
Cfap61 T C 2: 146,001,882 V296A probably benign Het
Cgnl1 C T 9: 71,645,649 R1011H probably benign Het
Cops4 C T 5: 100,543,875 R347C probably damaging Het
D16Ertd472e G T 16: 78,547,688 D177E probably benign Het
Dcdc2a T C 13: 25,107,617 V195A possibly damaging Het
Dpagt1 G A 9: 44,332,022 V285I probably benign Het
Dspp G T 5: 104,175,686 A232S probably damaging Het
Ephx2 G A 14: 66,110,455 Het
Fat1 T C 8: 44,952,474 V754A possibly damaging Het
Fstl3 G A 10: 79,780,031 C117Y probably damaging Het
Gldc A T 19: 30,099,914 S953T possibly damaging Het
Gm1123 T C 9: 99,010,980 N315S probably benign Het
Gm11639 T C 11: 104,724,585 I726T possibly damaging Het
Golga2 A G 2: 32,288,190 E37G Het
Gpr139 T A 7: 119,144,612 Q250L probably benign Het
Grik3 C T 4: 125,649,739 R283C probably damaging Het
Haao A C 17: 83,846,652 V22G probably damaging Het
Hspg2 T A 4: 137,539,179 F1884I probably damaging Het
Hyal3 G A 9: 107,584,967 G67S probably damaging Het
Kbtbd3 T A 9: 4,330,424 I266K probably benign Het
Klhl26 A C 8: 70,452,849 L137R probably damaging Het
Krt15 A T 11: 100,135,560 V100E possibly damaging Het
Lars A G 18: 42,210,018 probably null Het
Lats1 C T 10: 7,702,095 Q328* probably null Het
Lingo3 G A 10: 80,834,629 T489I probably damaging Het
Lmtk2 T C 5: 144,129,443 V65A possibly damaging Het
Lysmd1 T C 3: 95,138,484 S211P probably damaging Het
Med15 C T 16: 17,722,762 S21N unknown Het
Nav1 T C 1: 135,584,918 T135A probably benign Het
Nt5c1a G C 4: 123,208,479 R66T probably benign Het
Pclo T C 5: 14,682,010 Y3509H unknown Het
Pkp4 G A 2: 59,310,140 G397R possibly damaging Het
Ppp1r21 G A 17: 88,549,530 A138T probably benign Het
Pum3 A T 19: 27,424,242 V136D probably benign Het
Rab11fip3 A T 17: 26,068,152 D342E possibly damaging Het
Rcvrn T A 11: 67,700,057 W156R probably damaging Het
Rspry1 C T 8: 94,623,185 T67I probably benign Het
Sgsm3 T A 15: 81,008,820 V366E possibly damaging Het
Shank3 T G 15: 89,549,312 L1420R probably benign Het
Sirpb1b A T 3: 15,543,040 L215* probably null Het
Slc16a13 C T 11: 70,218,971 V235I probably benign Het
Slc16a14 T C 1: 84,929,466 D29G probably benign Het
Speer1 T C 5: 11,344,912 V122A probably benign Het
Spns2 T A 11: 72,456,878 T329S possibly damaging Het
Sufu G A 19: 46,450,669 probably null Het
Tll2 A G 19: 41,120,169 probably null Het
Trim10 G A 17: 36,869,881 M1I probably null Het
Trim42 A C 9: 97,359,129 N683K probably damaging Het
Trmt5 A G 12: 73,281,620 S270P probably damaging Het
Vmn1r59 C A 7: 5,453,987 R258L possibly damaging Het
Vmn2r32 A G 7: 7,479,852 L41S probably benign Het
Vmn2r93 A T 17: 18,305,067 E329V probably damaging Het
Ywhae G T 11: 75,764,661 E253* probably null Het
Other mutations in Serpina1d
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01410:Serpina1d APN 12 103763734 missense probably benign 0.00
IGL02175:Serpina1d APN 12 103765696 splice site probably null
IGL02336:Serpina1d APN 12 103764796 nonsense probably null
IGL03260:Serpina1d APN 12 103763849 missense probably damaging 0.98
R0119:Serpina1d UTSW 12 103765757 missense probably damaging 1.00
R0299:Serpina1d UTSW 12 103765757 missense probably damaging 1.00
R0348:Serpina1d UTSW 12 103763775 missense probably benign 0.05
R0499:Serpina1d UTSW 12 103765757 missense probably damaging 1.00
R1086:Serpina1d UTSW 12 103763787 missense probably benign
R1864:Serpina1d UTSW 12 103767997 missense probably benign 0.21
R1883:Serpina1d UTSW 12 103765778 missense possibly damaging 0.64
R1884:Serpina1d UTSW 12 103765778 missense possibly damaging 0.64
R3731:Serpina1d UTSW 12 103767905 missense possibly damaging 0.63
R3973:Serpina1d UTSW 12 103767848 missense probably benign 0.01
R3976:Serpina1d UTSW 12 103767848 missense probably benign 0.01
R4227:Serpina1d UTSW 12 103767481 missense probably benign 0.03
R4783:Serpina1d UTSW 12 103767824 missense possibly damaging 0.87
R5672:Serpina1d UTSW 12 103763842 missense possibly damaging 0.69
R5764:Serpina1d UTSW 12 103765821 missense probably benign 0.00
R6244:Serpina1d UTSW 12 103764828 unclassified probably null
R6314:Serpina1d UTSW 12 103764700 missense probably benign 0.39
R6548:Serpina1d UTSW 12 103767552 missense probably damaging 1.00
R6554:Serpina1d UTSW 12 103764803 missense probably benign 0.09
R6953:Serpina1d UTSW 12 103767730 missense probably benign 0.00
R7106:Serpina1d UTSW 12 103765721 missense probably benign 0.01
R8085:Serpina1d UTSW 12 103763828 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGCCTGATAATGGTTCTTGGCC -3'
(R):5'- GGATGTTCAGGAGACAGACACC -3'

Sequencing Primer
(F):5'- GATAATGGTTCTTGGCCTCTTCCAG -3'
(R):5'- ACCTCCCAGAAGGATCAGTC -3'
Posted On2019-09-13