Incidental Mutation 'R7390:Shank3'
ID573389
Institutional Source Beutler Lab
Gene Symbol Shank3
Ensembl Gene ENSMUSG00000022623
Gene NameSH3 and multiple ankyrin repeat domains 3
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.365) question?
Stock #R7390 (G1)
Quality Score225.009
Status Validated
Chromosome15
Chromosomal Location89499623-89560261 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 89549312 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Arginine at position 1420 (L1420R)
Ref Sequence ENSEMBL: ENSMUSP00000104932 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039074] [ENSMUST00000109309] [ENSMUST00000229559] [ENSMUST00000230807]
Predicted Effect
SMART Domains Protein: ENSMUSP00000048062
Gene: ENSMUSG00000022623
AA Change: L1345R

DomainStartEndE-ValueType
ANK 182 211 1.54e-1 SMART
ANK 215 245 3.36e2 SMART
ANK 249 278 2.47e0 SMART
ANK 282 311 3.71e-4 SMART
ANK 315 345 5.03e2 SMART
low complexity region 434 462 N/A INTRINSIC
SH3 473 528 1.28e-14 SMART
PDZ 579 664 3.95e-13 SMART
low complexity region 672 684 N/A INTRINSIC
low complexity region 813 843 N/A INTRINSIC
low complexity region 857 869 N/A INTRINSIC
low complexity region 905 923 N/A INTRINSIC
low complexity region 1078 1092 N/A INTRINSIC
low complexity region 1109 1121 N/A INTRINSIC
low complexity region 1173 1194 N/A INTRINSIC
low complexity region 1235 1252 N/A INTRINSIC
low complexity region 1266 1278 N/A INTRINSIC
low complexity region 1318 1332 N/A INTRINSIC
low complexity region 1341 1355 N/A INTRINSIC
low complexity region 1370 1395 N/A INTRINSIC
low complexity region 1409 1427 N/A INTRINSIC
low complexity region 1552 1558 N/A INTRINSIC
low complexity region 1584 1599 N/A INTRINSIC
low complexity region 1626 1658 N/A INTRINSIC
SAM 1664 1730 3.08e-18 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000109309
AA Change: L1420R

PolyPhen 2 Score 0.051 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000104932
Gene: ENSMUSG00000022623
AA Change: L1420R

DomainStartEndE-ValueType
low complexity region 5 55 N/A INTRINSIC
Pfam:FERM_f0 84 167 2.5e-14 PFAM
ANK 257 286 1.54e-1 SMART
ANK 290 320 3.36e2 SMART
ANK 324 353 2.47e0 SMART
ANK 357 386 3.71e-4 SMART
ANK 390 420 5.03e2 SMART
low complexity region 509 537 N/A INTRINSIC
SH3 548 603 1.28e-14 SMART
PDZ 654 739 3.95e-13 SMART
low complexity region 747 759 N/A INTRINSIC
low complexity region 888 918 N/A INTRINSIC
low complexity region 932 944 N/A INTRINSIC
low complexity region 980 998 N/A INTRINSIC
low complexity region 1153 1167 N/A INTRINSIC
low complexity region 1184 1196 N/A INTRINSIC
low complexity region 1248 1269 N/A INTRINSIC
low complexity region 1310 1327 N/A INTRINSIC
low complexity region 1341 1353 N/A INTRINSIC
low complexity region 1393 1407 N/A INTRINSIC
low complexity region 1416 1430 N/A INTRINSIC
low complexity region 1445 1470 N/A INTRINSIC
low complexity region 1484 1502 N/A INTRINSIC
low complexity region 1627 1633 N/A INTRINSIC
low complexity region 1659 1674 N/A INTRINSIC
low complexity region 1701 1733 N/A INTRINSIC
SAM 1739 1805 3.08e-18 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000229559
Predicted Effect probably benign
Transcript: ENSMUST00000230807
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 97% (66/68)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the Shank gene family. Shank proteins are multidomain scaffold proteins of the postsynaptic density that connect neurotransmitter receptors, ion channels, and other membrane proteins to the actin cytoskeleton and G-protein-coupled signaling pathways. Shank proteins also play a role in synapse formation and dendritic spine maturation. Mutations in this gene are a cause of autism spectrum disorder (ASD), which is characterized by impairments in social interaction and communication, and restricted behavioral patterns and interests. Mutations in this gene also cause schizophrenia type 15, and are a major causative factor in the neurological symptoms of 22q13.3 deletion syndrome, which is also known as Phelan-McDermid syndrome. Additional isoforms have been described for this gene but they have not yet been experimentally verified. [provided by RefSeq, Mar 2012]
PHENOTYPE: Mice carrying various deletions of exons encoding the ankyrin repeats (exons 4-9) exhibit a range of synaptic and autism-related impairments. Homozygotes lacking exon 9 show altered excitation/inhibition balance, increased rearing, and mildly impaired spatial memory. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1190002N15Rik A G 9: 94,537,383 S165P probably damaging Het
4930486L24Rik A T 13: 60,844,338 D291E probably benign Het
Abca9 C T 11: 110,145,661 V541I probably benign Het
Adamts15 A T 9: 30,911,108 probably null Het
Adgrg7 A G 16: 56,732,844 I630T probably damaging Het
Ahnak A G 19: 9,003,205 I618V probably benign Het
Amotl2 T A 9: 102,731,690 V801E probably damaging Het
Ankrd17 T C 5: 90,282,920 T1002A probably benign Het
Bmp7 C T 2: 172,870,205 D409N probably damaging Het
Bpifb2 A G 2: 153,889,806 N293S possibly damaging Het
Ccdc162 A G 10: 41,634,048 C854R probably benign Het
Ccdc171 A G 4: 83,818,067 E1225G probably damaging Het
Cep350 T C 1: 155,866,087 E2146G possibly damaging Het
Ces1a A C 8: 93,044,841 probably null Het
Cfap45 T G 1: 172,541,358 D444E probably benign Het
Cfap61 T C 2: 146,001,882 V296A probably benign Het
Cgnl1 C T 9: 71,645,649 R1011H probably benign Het
Cops4 C T 5: 100,543,875 R347C probably damaging Het
D16Ertd472e G T 16: 78,547,688 D177E probably benign Het
Dcdc2a T C 13: 25,107,617 V195A possibly damaging Het
Dpagt1 G A 9: 44,332,022 V285I probably benign Het
Dspp G T 5: 104,175,686 A232S probably damaging Het
Ephx2 G A 14: 66,110,455 Het
Fat1 T C 8: 44,952,474 V754A possibly damaging Het
Fstl3 G A 10: 79,780,031 C117Y probably damaging Het
Gldc A T 19: 30,099,914 S953T possibly damaging Het
Gm1123 T C 9: 99,010,980 N315S probably benign Het
Gm11639 T C 11: 104,724,585 I726T possibly damaging Het
Golga2 A G 2: 32,288,190 E37G Het
Gpr139 T A 7: 119,144,612 Q250L probably benign Het
Grik3 C T 4: 125,649,739 R283C probably damaging Het
Haao A C 17: 83,846,652 V22G probably damaging Het
Hspg2 T A 4: 137,539,179 F1884I probably damaging Het
Hyal3 G A 9: 107,584,967 G67S probably damaging Het
Kbtbd3 T A 9: 4,330,424 I266K probably benign Het
Klhl26 A C 8: 70,452,849 L137R probably damaging Het
Krt15 A T 11: 100,135,560 V100E possibly damaging Het
Lars A G 18: 42,210,018 probably null Het
Lats1 C T 10: 7,702,095 Q328* probably null Het
Lingo3 G A 10: 80,834,629 T489I probably damaging Het
Lmtk2 T C 5: 144,129,443 V65A possibly damaging Het
Lysmd1 T C 3: 95,138,484 S211P probably damaging Het
Med15 C T 16: 17,722,762 S21N unknown Het
Nav1 T C 1: 135,584,918 T135A probably benign Het
Nt5c1a G C 4: 123,208,479 R66T probably benign Het
Pclo T C 5: 14,682,010 Y3509H unknown Het
Pkp4 G A 2: 59,310,140 G397R possibly damaging Het
Ppp1r21 G A 17: 88,549,530 A138T probably benign Het
Pum3 A T 19: 27,424,242 V136D probably benign Het
Rab11fip3 A T 17: 26,068,152 D342E possibly damaging Het
Rcvrn T A 11: 67,700,057 W156R probably damaging Het
Rspry1 C T 8: 94,623,185 T67I probably benign Het
Serpina1d T C 12: 103,767,778 D89G possibly damaging Het
Sgsm3 T A 15: 81,008,820 V366E possibly damaging Het
Sirpb1b A T 3: 15,543,040 L215* probably null Het
Slc16a13 C T 11: 70,218,971 V235I probably benign Het
Slc16a14 T C 1: 84,929,466 D29G probably benign Het
Speer1 T C 5: 11,344,912 V122A probably benign Het
Spns2 T A 11: 72,456,878 T329S possibly damaging Het
Sufu G A 19: 46,450,669 probably null Het
Tll2 A G 19: 41,120,169 probably null Het
Trim10 G A 17: 36,869,881 M1I probably null Het
Trim42 A C 9: 97,359,129 N683K probably damaging Het
Trmt5 A G 12: 73,281,620 S270P probably damaging Het
Vmn1r59 C A 7: 5,453,987 R258L possibly damaging Het
Vmn2r32 A G 7: 7,479,852 L41S probably benign Het
Vmn2r93 A T 17: 18,305,067 E329V probably damaging Het
Ywhae G T 11: 75,764,661 E253* probably null Het
Other mutations in Shank3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01070:Shank3 APN 15 89549416 missense probably damaging 1.00
IGL01469:Shank3 APN 15 89521274 missense probably damaging 1.00
IGL01886:Shank3 APN 15 89531663 missense probably damaging 1.00
IGL01934:Shank3 APN 15 89549846 missense probably damaging 1.00
IGL01989:Shank3 APN 15 89503299 splice site probably benign
IGL02004:Shank3 APN 15 89503299 splice site probably benign
IGL02085:Shank3 APN 15 89503915 critical splice donor site probably null
IGL02195:Shank3 APN 15 89548118 missense probably damaging 1.00
IGL02354:Shank3 APN 15 89504333 missense probably damaging 1.00
IGL02361:Shank3 APN 15 89504333 missense probably damaging 1.00
IGL02541:Shank3 APN 15 89501410 missense probably damaging 1.00
R0294:Shank3 UTSW 15 89532098 missense probably damaging 1.00
R0468:Shank3 UTSW 15 89549275 missense probably benign 0.28
R0483:Shank3 UTSW 15 89543239 splice site probably benign
R0605:Shank3 UTSW 15 89524147 missense possibly damaging 0.49
R0675:Shank3 UTSW 15 89531388 missense possibly damaging 0.92
R1082:Shank3 UTSW 15 89549371 missense probably damaging 1.00
R1576:Shank3 UTSW 15 89503663 missense probably benign 0.11
R1702:Shank3 UTSW 15 89499896 missense probably damaging 0.99
R1726:Shank3 UTSW 15 89557986 missense probably damaging 1.00
R1958:Shank3 UTSW 15 89503148 missense probably damaging 0.99
R1961:Shank3 UTSW 15 89557964 missense possibly damaging 0.60
R2420:Shank3 UTSW 15 89521210 nonsense probably null
R2513:Shank3 UTSW 15 89548686 missense probably benign 0.05
R3917:Shank3 UTSW 15 89503384 missense possibly damaging 0.77
R4163:Shank3 UTSW 15 89549594 missense probably damaging 1.00
R4205:Shank3 UTSW 15 89503318 missense probably damaging 1.00
R4434:Shank3 UTSW 15 89503359 missense probably damaging 1.00
R4791:Shank3 UTSW 15 89500354 missense probably damaging 1.00
R4816:Shank3 UTSW 15 89543115 missense probably damaging 1.00
R4828:Shank3 UTSW 15 89500199 intron probably benign
R4911:Shank3 UTSW 15 89504344 missense probably damaging 1.00
R4997:Shank3 UTSW 15 89549698 missense probably damaging 1.00
R5213:Shank3 UTSW 15 89533278 missense possibly damaging 0.82
R5338:Shank3 UTSW 15 89531711 splice site probably null
R5494:Shank3 UTSW 15 89548238 missense probably damaging 0.99
R5543:Shank3 UTSW 15 89532354 missense probably damaging 1.00
R5654:Shank3 UTSW 15 89521326 missense probably benign 0.07
R5900:Shank3 UTSW 15 89503390 missense probably damaging 1.00
R5906:Shank3 UTSW 15 89548916 missense probably damaging 1.00
R6385:Shank3 UTSW 15 89521375 critical splice donor site probably null
R6432:Shank3 UTSW 15 89503413 missense possibly damaging 0.75
R6724:Shank3 UTSW 15 89532453 missense probably damaging 1.00
R6822:Shank3 UTSW 15 89531627 missense probably damaging 1.00
R6845:Shank3 UTSW 15 89548325 missense probably benign 0.00
R7088:Shank3 UTSW 15 89503525 splice site probably null
R7808:Shank3 UTSW 15 89548880 missense probably damaging 1.00
R7862:Shank3 UTSW 15 89505445 missense possibly damaging 0.73
R7945:Shank3 UTSW 15 89505445 missense possibly damaging 0.73
R8039:Shank3 UTSW 15 89505439 missense probably damaging 1.00
R8090:Shank3 UTSW 15 89505458 critical splice donor site probably null
RF020:Shank3 UTSW 15 89500390 missense probably benign 0.20
Z1177:Shank3 UTSW 15 89558322 makesense probably null
Predicted Primers PCR Primer
(F):5'- GAGCTGGTATTCGCTGTGAACC -3'
(R):5'- GTGGCTTCTCGAGTAGAAAAGTGTG -3'

Sequencing Primer
(F):5'- GTATTCGCTGTGAACCTGCCAC -3'
(R):5'- TCTCGAGTAGAAAAGTGTGTCCATCG -3'
Posted On2019-09-13