Incidental Mutation 'R0648:Plxnd1'
ID 57341
Institutional Source Beutler Lab
Gene Symbol Plxnd1
Ensembl Gene ENSMUSG00000030123
Gene Name plexin D1
Synonyms b2b553Clo, 6230425C21Rik, b2b1863Clo
MMRRC Submission 038833-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R0648 (G1)
Quality Score 225
Status Validated
Chromosome 6
Chromosomal Location 115954811-115995005 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 115994001 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Valine at position 269 (I269V)
Ref Sequence ENSEMBL: ENSMUSP00000015511 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000015511]
AlphaFold Q3UH93
Predicted Effect possibly damaging
Transcript: ENSMUST00000015511
AA Change: I269V

PolyPhen 2 Score 0.857 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000015511
Gene: ENSMUSG00000030123
AA Change: I269V

DomainStartEndE-ValueType
signal peptide 1 48 N/A INTRINSIC
Sema 61 531 6.52e-90 SMART
PSI 550 603 6.06e-12 SMART
PSI 703 755 1.06e-2 SMART
Blast:PSI 850 891 9e-20 BLAST
IPT 892 981 4.43e-20 SMART
IPT 982 1068 6.61e-19 SMART
IPT 1070 1149 6.13e-14 SMART
transmembrane domain 1271 1293 N/A INTRINSIC
Pfam:Plexin_cytopl 1345 1888 5e-238 PFAM
Meta Mutation Damage Score 0.0802 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.6%
  • 20x: 96.0%
Validation Efficiency 100% (80/80)
MGI Phenotype PHENOTYPE: Homozygous null mice display neonatal lethality, thin-walled atria, and vascular abnormalities including abnormal branchial arch artery development, cardiac outflow tract abnormalities, and reduced vascular smooth muscle around some vessels. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4922502D21Rik A G 6: 129,330,969 F46L probably benign Het
Abcc5 A G 16: 20,365,882 V1009A possibly damaging Het
Acta2 T C 19: 34,248,534 I87V probably benign Het
Arid1a A G 4: 133,685,204 Y1560H unknown Het
Bcor C T X: 12,059,051 R102Q probably damaging Het
Camsap2 A T 1: 136,304,319 D179E probably damaging Het
Ccdc18 T A 5: 108,135,560 S46T probably damaging Het
Ccdc18 A C 5: 108,174,987 Q651P probably damaging Het
Cdc73 T C 1: 143,695,462 T80A probably benign Het
Cdh7 T A 1: 110,065,607 probably benign Het
Cenpe G A 3: 135,230,082 G426D probably damaging Het
Cenpt A G 8: 105,844,960 V487A probably damaging Het
Col4a1 G A 8: 11,246,892 P84S unknown Het
Dennd2d A G 3: 106,500,555 I450M probably damaging Het
Dhps C A 8: 85,073,282 probably null Het
Ebf1 A T 11: 44,991,510 H431L probably damaging Het
Efcab6 A G 15: 83,933,064 probably benign Het
Egflam T C 15: 7,207,709 H990R probably damaging Het
Ercc6l2 A G 13: 63,844,645 T303A probably benign Het
Fam160a1 A C 3: 85,730,614 V126G probably damaging Het
Fam167b T C 4: 129,578,357 K7E probably benign Het
Fgd3 T C 13: 49,296,573 I67V probably benign Het
Fn1 A T 1: 71,597,585 V2045D possibly damaging Het
Gm10451 A G 12: 76,451,296 noncoding transcript Het
Gm8251 A G 1: 44,056,563 S1792P possibly damaging Het
Gnl1 A G 17: 35,982,598 N225S probably damaging Het
Gpx6 A T 13: 21,318,877 N154Y probably benign Het
Haus8 C A 8: 71,256,530 G79V probably damaging Het
Hdgfl1 A T 13: 26,769,853 L79Q probably damaging Het
Hist2h2be A G 3: 96,221,535 S124G probably benign Het
Impdh2 T C 9: 108,563,466 Y83H probably benign Het
Lama2 T C 10: 26,989,376 T2929A probably benign Het
Lpin2 T C 17: 71,229,312 S199P probably benign Het
Mkl1 A G 15: 81,016,920 S457P probably damaging Het
Moap1 T C 12: 102,742,517 T258A probably benign Het
Mrps35 C A 6: 147,055,945 S156* probably null Het
Mtbp C T 15: 55,603,201 P537S probably benign Het
Ncstn C A 1: 172,067,887 V565F probably benign Het
Nhsl1 A G 10: 18,531,726 N1536S possibly damaging Het
Nkain4 T C 2: 180,943,112 Q103R possibly damaging Het
Nsun2 T A 13: 69,627,587 N383K probably damaging Het
Olfr1342 C T 4: 118,690,072 V127I probably benign Het
Olfr820 A G 10: 130,017,481 N40S probably damaging Het
Parp1 C T 1: 180,600,440 probably benign Het
Pkd1 G A 17: 24,594,937 R4125H probably damaging Het
Qrich1 T A 9: 108,544,877 N563K probably damaging Het
Rab3il1 TGAAG TGAAGAAG 19: 10,027,388 probably benign Het
Rell1 G A 5: 63,924,745 T271M probably benign Het
Rgl1 A G 1: 152,536,265 probably null Het
Rph3a C T 5: 120,959,270 R261H possibly damaging Het
Ryr2 A T 13: 11,724,333 M2161K possibly damaging Het
Scaf11 T C 15: 96,418,458 N1075S possibly damaging Het
Serpina3j A G 12: 104,314,679 D37G probably benign Het
Siah2 A G 3: 58,676,214 V217A probably damaging Het
Sik2 T C 9: 50,898,745 D506G probably benign Het
Skap2 A C 6: 51,879,785 V279G probably benign Het
Slc8a3 G T 12: 81,314,446 T533N probably damaging Het
Slc9a7 A T X: 20,162,420 probably benign Het
Snai3 G T 8: 122,454,994 F241L probably damaging Het
Speg T C 1: 75,427,978 S2805P probably benign Het
Spink5 A T 18: 43,999,797 probably benign Het
Tctn1 C T 5: 122,251,698 E254K probably benign Het
Tdrd3 C T 14: 87,472,182 T100M probably damaging Het
Tex47 T C 5: 7,305,215 V132A probably benign Het
Thbs3 A G 3: 89,216,665 probably null Het
Tigit T A 16: 43,662,038 Y111F probably damaging Het
Tmem245 A G 4: 56,906,270 I148T probably benign Het
Tmem97 A G 11: 78,550,539 Y39H probably benign Het
Tnks2 T A 19: 36,862,074 probably null Het
Trp53bp1 A G 2: 121,235,707 V846A probably benign Het
Tulp2 T G 7: 45,519,786 I259S probably damaging Het
Twistnb C T 12: 33,438,000 Q305* probably null Het
Ubxn1 G A 19: 8,874,248 R215H probably damaging Het
Vmn1r17 A G 6: 57,360,475 F253L probably damaging Het
Vmn2r10 T C 5: 108,995,916 M723V probably benign Het
Xndc1 T C 7: 102,078,824 V14A possibly damaging Het
Xpnpep1 A G 19: 52,997,863 probably benign Het
Yes1 T A 5: 32,655,518 M322K possibly damaging Het
Zdhhc14 C A 17: 5,493,602 N52K probably benign Het
Zfp42 A G 8: 43,295,978 V162A probably benign Het
Other mutations in Plxnd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00764:Plxnd1 APN 6 115967972 missense possibly damaging 0.51
IGL01099:Plxnd1 APN 6 115969945 missense probably benign
IGL01323:Plxnd1 APN 6 115966799 missense possibly damaging 0.81
IGL01382:Plxnd1 APN 6 115960527 missense probably damaging 1.00
IGL01786:Plxnd1 APN 6 115959935 missense probably damaging 1.00
IGL02244:Plxnd1 APN 6 115978257 missense probably benign 0.39
IGL02272:Plxnd1 APN 6 115993628 missense probably damaging 1.00
IGL02293:Plxnd1 APN 6 115963913 missense probably damaging 1.00
IGL02465:Plxnd1 APN 6 115955742 makesense probably null
IGL02873:Plxnd1 APN 6 115959976 missense probably damaging 1.00
IGL03209:Plxnd1 APN 6 115962357 missense probably damaging 1.00
Hiss UTSW 6 115969929 missense possibly damaging 0.94
murmer UTSW 6 115968793 missense probably benign 0.00
mutter UTSW 6 115968044 missense probably benign 0.27
rattle UTSW 6 115959794 missense probably damaging 0.96
R0238:Plxnd1 UTSW 6 115968793 missense probably benign 0.00
R0238:Plxnd1 UTSW 6 115968793 missense probably benign 0.00
R0239:Plxnd1 UTSW 6 115968793 missense probably benign 0.00
R0239:Plxnd1 UTSW 6 115968793 missense probably benign 0.00
R0357:Plxnd1 UTSW 6 115969460 missense probably benign 0.00
R0646:Plxnd1 UTSW 6 115958699 splice site probably benign
R0718:Plxnd1 UTSW 6 115966638 missense possibly damaging 0.68
R1116:Plxnd1 UTSW 6 115967005 splice site probably null
R1292:Plxnd1 UTSW 6 115962683 unclassified probably benign
R1715:Plxnd1 UTSW 6 115968681 missense probably benign 0.02
R1760:Plxnd1 UTSW 6 115967779 missense possibly damaging 0.95
R1799:Plxnd1 UTSW 6 115994057 missense probably damaging 1.00
R1817:Plxnd1 UTSW 6 115980601 missense possibly damaging 0.83
R1848:Plxnd1 UTSW 6 115966546 missense probably damaging 1.00
R1851:Plxnd1 UTSW 6 115963914 missense probably damaging 1.00
R1864:Plxnd1 UTSW 6 115969441 splice site probably null
R1865:Plxnd1 UTSW 6 115969441 splice site probably null
R1875:Plxnd1 UTSW 6 115978084 splice site probably null
R1899:Plxnd1 UTSW 6 115969363 missense probably benign
R1913:Plxnd1 UTSW 6 115978017 missense possibly damaging 0.50
R1970:Plxnd1 UTSW 6 115962517 missense probably damaging 1.00
R2007:Plxnd1 UTSW 6 115967255 missense probably damaging 1.00
R2134:Plxnd1 UTSW 6 115957548 missense probably damaging 1.00
R2202:Plxnd1 UTSW 6 115962764 missense probably benign 0.45
R2230:Plxnd1 UTSW 6 115964144 missense probably damaging 1.00
R2267:Plxnd1 UTSW 6 115962743 missense probably benign 0.29
R2427:Plxnd1 UTSW 6 115967748 critical splice donor site probably null
R4108:Plxnd1 UTSW 6 115959315 missense probably damaging 1.00
R4233:Plxnd1 UTSW 6 115965953 missense probably benign 0.30
R4280:Plxnd1 UTSW 6 115956094 splice site probably benign
R4280:Plxnd1 UTSW 6 115956095 splice site probably null
R4346:Plxnd1 UTSW 6 115977980 missense probably benign 0.16
R4439:Plxnd1 UTSW 6 115993976 missense probably damaging 0.99
R4572:Plxnd1 UTSW 6 115955756 missense probably damaging 1.00
R4576:Plxnd1 UTSW 6 115968044 missense probably benign 0.27
R4599:Plxnd1 UTSW 6 115994276 missense probably damaging 1.00
R4614:Plxnd1 UTSW 6 115972525 missense possibly damaging 0.83
R4700:Plxnd1 UTSW 6 115958615 missense probably damaging 1.00
R4705:Plxnd1 UTSW 6 115958620 missense probably damaging 1.00
R4806:Plxnd1 UTSW 6 115960855 missense probably damaging 1.00
R4944:Plxnd1 UTSW 6 115955765 missense probably damaging 1.00
R4977:Plxnd1 UTSW 6 115994376 missense probably damaging 1.00
R5069:Plxnd1 UTSW 6 115965901 missense probably damaging 0.98
R5155:Plxnd1 UTSW 6 115958988 critical splice donor site probably null
R5460:Plxnd1 UTSW 6 115957648 missense probably damaging 1.00
R5729:Plxnd1 UTSW 6 115965877 missense probably damaging 1.00
R5909:Plxnd1 UTSW 6 115968688 missense probably benign 0.00
R5992:Plxnd1 UTSW 6 115967787 critical splice acceptor site probably null
R6129:Plxnd1 UTSW 6 115978174 missense probably damaging 1.00
R6254:Plxnd1 UTSW 6 115977960 missense probably benign 0.01
R6273:Plxnd1 UTSW 6 115978492 missense probably damaging 1.00
R6310:Plxnd1 UTSW 6 115976736 missense possibly damaging 0.94
R6732:Plxnd1 UTSW 6 115969929 missense possibly damaging 0.94
R6857:Plxnd1 UTSW 6 115993763 missense probably benign 0.05
R7243:Plxnd1 UTSW 6 115972507 missense probably benign 0.00
R7282:Plxnd1 UTSW 6 115960837 missense probably damaging 1.00
R7632:Plxnd1 UTSW 6 115976639 missense probably benign
R7699:Plxnd1 UTSW 6 115959794 missense probably damaging 0.96
R7915:Plxnd1 UTSW 6 115966918 missense probably benign 0.00
R8090:Plxnd1 UTSW 6 115956617 missense probably damaging 1.00
R8382:Plxnd1 UTSW 6 115972472 missense probably benign
R8507:Plxnd1 UTSW 6 115966905 missense probably damaging 0.97
R8539:Plxnd1 UTSW 6 115962807 missense possibly damaging 0.94
R8548:Plxnd1 UTSW 6 115957597 missense probably damaging 1.00
R8963:Plxnd1 UTSW 6 115972545 nonsense probably null
R9119:Plxnd1 UTSW 6 115955871 splice site probably benign
R9177:Plxnd1 UTSW 6 115966508 missense probably benign 0.00
R9182:Plxnd1 UTSW 6 115993785 missense probably damaging 0.98
R9185:Plxnd1 UTSW 6 115957565 missense probably damaging 1.00
R9226:Plxnd1 UTSW 6 115957563 missense probably damaging 1.00
R9433:Plxnd1 UTSW 6 115968793 missense probably benign 0.00
R9449:Plxnd1 UTSW 6 115955769 missense probably damaging 1.00
R9451:Plxnd1 UTSW 6 115963316 missense possibly damaging 0.72
R9599:Plxnd1 UTSW 6 115963313 missense possibly damaging 0.78
R9627:Plxnd1 UTSW 6 115963313 missense possibly damaging 0.78
R9644:Plxnd1 UTSW 6 115963313 missense possibly damaging 0.78
X0024:Plxnd1 UTSW 6 115963310 missense probably benign 0.02
X0026:Plxnd1 UTSW 6 115966784 missense possibly damaging 0.88
Z1088:Plxnd1 UTSW 6 115967510 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- TCGAAGACAGCGAAGAACTGCTC -3'
(R):5'- ATCTACCAGGGTCTGTGCCAGC -3'

Sequencing Primer
(F):5'- GCTGTAGAGGTcgccgc -3'
(R):5'- GGCAACATCTCAGCCCTG -3'
Posted On 2013-07-11