Incidental Mutation 'R0648:Tulp2'
ID 57344
Institutional Source Beutler Lab
Gene Symbol Tulp2
Ensembl Gene ENSMUSG00000023467
Gene Name tubby-like protein 2
Synonyms
MMRRC Submission 038833-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.095) question?
Stock # R0648 (G1)
Quality Score 225
Status Validated
Chromosome 7
Chromosomal Location 45131450-45173070 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to G at 45169210 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Serine at position 259 (I259S)
Ref Sequence ENSEMBL: ENSMUSP00000147710 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024233] [ENSMUST00000042105] [ENSMUST00000085331] [ENSMUST00000107758] [ENSMUST00000107759] [ENSMUST00000107762] [ENSMUST00000167273] [ENSMUST00000209763] [ENSMUST00000210299] [ENSMUST00000210868] [ENSMUST00000210813] [ENSMUST00000210532] [ENSMUST00000211212]
AlphaFold P46686
Predicted Effect probably damaging
Transcript: ENSMUST00000024233
AA Change: I371S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000024233
Gene: ENSMUSG00000023467
AA Change: I371S

DomainStartEndE-ValueType
low complexity region 67 77 N/A INTRINSIC
low complexity region 212 220 N/A INTRINSIC
Pfam:Tub 315 556 1.1e-116 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000042105
SMART Domains Protein: ENSMUSP00000049488
Gene: ENSMUSG00000040435

DomainStartEndE-ValueType
low complexity region 149 160 N/A INTRINSIC
low complexity region 225 234 N/A INTRINSIC
internal_repeat_1 245 333 1.03e-15 PROSPERO
low complexity region 334 351 N/A INTRINSIC
internal_repeat_1 357 447 1.03e-15 PROSPERO
low complexity region 448 459 N/A INTRINSIC
low complexity region 520 530 N/A INTRINSIC
Pfam:PP1c_bdg 536 612 8.2e-15 PFAM
low complexity region 636 652 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000085331
AA Change: I247S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000082438
Gene: ENSMUSG00000023467
AA Change: I247S

DomainStartEndE-ValueType
low complexity region 88 96 N/A INTRINSIC
Pfam:Tub 191 432 6.2e-117 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000107758
AA Change: I266S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000103387
Gene: ENSMUSG00000023467
AA Change: I266S

DomainStartEndE-ValueType
low complexity region 100 108 N/A INTRINSIC
Pfam:Tub 203 451 4.1e-85 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000107759
AA Change: I259S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000103388
Gene: ENSMUSG00000023467
AA Change: I259S

DomainStartEndE-ValueType
low complexity region 100 108 N/A INTRINSIC
Pfam:Tub 203 444 3.4e-117 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000107762
AA Change: I371S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000103391
Gene: ENSMUSG00000023467
AA Change: I371S

DomainStartEndE-ValueType
Pfam:Tub_N 39 295 8.8e-36 PFAM
Pfam:Tub 315 556 1.3e-85 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000167273
SMART Domains Protein: ENSMUSP00000128497
Gene: ENSMUSG00000040435

DomainStartEndE-ValueType
low complexity region 149 160 N/A INTRINSIC
low complexity region 225 234 N/A INTRINSIC
internal_repeat_1 245 333 1.03e-15 PROSPERO
low complexity region 334 351 N/A INTRINSIC
internal_repeat_1 357 447 1.03e-15 PROSPERO
low complexity region 448 459 N/A INTRINSIC
low complexity region 520 530 N/A INTRINSIC
Pfam:PP1c_bdg 531 612 1.1e-20 PFAM
low complexity region 636 652 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000209763
Predicted Effect probably benign
Transcript: ENSMUST00000210299
Predicted Effect probably damaging
Transcript: ENSMUST00000210868
AA Change: I259S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000210813
AA Change: I266S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably benign
Transcript: ENSMUST00000210532
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211413
Predicted Effect probably benign
Transcript: ENSMUST00000211212
Meta Mutation Damage Score 0.7415 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.6%
  • 20x: 96.0%
Validation Efficiency 100% (80/80)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] TULP2 is a member of a family of tubby-like genes (TULPs) that encode proteins of unknown function. Members of this family have been identified in plants, vertebrates, and invertebrates. The TULP proteins share a conserved C-terminal region of approximately 200 amino acid residues. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc5 A G 16: 20,184,632 (GRCm39) V1009A possibly damaging Het
Acta2 T C 19: 34,225,934 (GRCm39) I87V probably benign Het
Arid1a A G 4: 133,412,515 (GRCm39) Y1560H unknown Het
Bcor C T X: 11,925,290 (GRCm39) R102Q probably damaging Het
Camsap2 A T 1: 136,232,057 (GRCm39) D179E probably damaging Het
Ccdc168 A G 1: 44,095,723 (GRCm39) S1792P possibly damaging Het
Ccdc18 T A 5: 108,283,426 (GRCm39) S46T probably damaging Het
Ccdc18 A C 5: 108,322,853 (GRCm39) Q651P probably damaging Het
Cdc73 T C 1: 143,571,200 (GRCm39) T80A probably benign Het
Cdh20 T A 1: 109,993,337 (GRCm39) probably benign Het
Cenpe G A 3: 134,935,843 (GRCm39) G426D probably damaging Het
Cenpt A G 8: 106,571,592 (GRCm39) V487A probably damaging Het
Clec2m A G 6: 129,307,932 (GRCm39) F46L probably benign Het
Col4a1 G A 8: 11,296,892 (GRCm39) P84S unknown Het
Dennd2d A G 3: 106,407,871 (GRCm39) I450M probably damaging Het
Dhps C A 8: 85,799,911 (GRCm39) probably null Het
Ebf1 A T 11: 44,882,337 (GRCm39) H431L probably damaging Het
Efcab6 A G 15: 83,817,265 (GRCm39) probably benign Het
Egflam T C 15: 7,237,190 (GRCm39) H990R probably damaging Het
Ercc6l2 A G 13: 63,992,459 (GRCm39) T303A probably benign Het
Fam167b T C 4: 129,472,150 (GRCm39) K7E probably benign Het
Fgd3 T C 13: 49,450,049 (GRCm39) I67V probably benign Het
Fhip1a A C 3: 85,637,921 (GRCm39) V126G probably damaging Het
Fn1 A T 1: 71,636,744 (GRCm39) V2045D possibly damaging Het
Gnl1 A G 17: 36,293,490 (GRCm39) N225S probably damaging Het
Gpx6 A T 13: 21,503,047 (GRCm39) N154Y probably benign Het
H2bc21 A G 3: 96,128,851 (GRCm39) S124G probably benign Het
Haus8 C A 8: 71,709,174 (GRCm39) G79V probably damaging Het
Hdgfl1 A T 13: 26,953,836 (GRCm39) L79Q probably damaging Het
Impdh2 T C 9: 108,440,665 (GRCm39) Y83H probably benign Het
Lama2 T C 10: 26,865,372 (GRCm39) T2929A probably benign Het
Lpin2 T C 17: 71,536,307 (GRCm39) S199P probably benign Het
Moap1 T C 12: 102,708,776 (GRCm39) T258A probably benign Het
Mrps35 C A 6: 146,957,443 (GRCm39) S156* probably null Het
Mrtfa A G 15: 80,901,121 (GRCm39) S457P probably damaging Het
Mtbp C T 15: 55,466,597 (GRCm39) P537S probably benign Het
Ncstn C A 1: 171,895,454 (GRCm39) V565F probably benign Het
Nhsl1 A G 10: 18,407,474 (GRCm39) N1536S possibly damaging Het
Nkain4 T C 2: 180,584,905 (GRCm39) Q103R possibly damaging Het
Nsun2 T A 13: 69,775,706 (GRCm39) N383K probably damaging Het
Or13p4 C T 4: 118,547,269 (GRCm39) V127I probably benign Het
Or6c33 A G 10: 129,853,350 (GRCm39) N40S probably damaging Het
Parp1 C T 1: 180,428,005 (GRCm39) probably benign Het
Pkd1 G A 17: 24,813,911 (GRCm39) R4125H probably damaging Het
Plxnd1 T C 6: 115,970,962 (GRCm39) I269V possibly damaging Het
Polr1f C T 12: 33,487,999 (GRCm39) Q305* probably null Het
Ppp1r36dn A G 12: 76,498,070 (GRCm39) noncoding transcript Het
Qrich1 T A 9: 108,422,076 (GRCm39) N563K probably damaging Het
Rab3il1 TGAAG TGAAGAAG 19: 10,004,752 (GRCm39) probably benign Het
Rell1 G A 5: 64,082,088 (GRCm39) T271M probably benign Het
Rgl1 A G 1: 152,412,016 (GRCm39) probably null Het
Rph3a C T 5: 121,097,333 (GRCm39) R261H possibly damaging Het
Ryr2 A T 13: 11,739,219 (GRCm39) M2161K possibly damaging Het
Scaf11 T C 15: 96,316,339 (GRCm39) N1075S possibly damaging Het
Serpina3j A G 12: 104,280,938 (GRCm39) D37G probably benign Het
Siah2 A G 3: 58,583,635 (GRCm39) V217A probably damaging Het
Sik2 T C 9: 50,810,045 (GRCm39) D506G probably benign Het
Skap2 A C 6: 51,856,765 (GRCm39) V279G probably benign Het
Slc8a3 G T 12: 81,361,220 (GRCm39) T533N probably damaging Het
Slc9a7 A T X: 20,028,659 (GRCm39) probably benign Het
Snai3 G T 8: 123,181,733 (GRCm39) F241L probably damaging Het
Speg T C 1: 75,404,622 (GRCm39) S2805P probably benign Het
Spink5 A T 18: 44,132,864 (GRCm39) probably benign Het
Tctn1 C T 5: 122,389,761 (GRCm39) E254K probably benign Het
Tdrd3 C T 14: 87,709,618 (GRCm39) T100M probably damaging Het
Tex47 T C 5: 7,355,215 (GRCm39) V132A probably benign Het
Thbs3 A G 3: 89,123,972 (GRCm39) probably null Het
Tigit T A 16: 43,482,401 (GRCm39) Y111F probably damaging Het
Tmem245 A G 4: 56,906,270 (GRCm39) I148T probably benign Het
Tmem97 A G 11: 78,441,365 (GRCm39) Y39H probably benign Het
Tnks2 T A 19: 36,839,474 (GRCm39) probably null Het
Trp53bp1 A G 2: 121,066,188 (GRCm39) V846A probably benign Het
Ubxn1 G A 19: 8,851,612 (GRCm39) R215H probably damaging Het
Vmn1r17 A G 6: 57,337,460 (GRCm39) F253L probably damaging Het
Vmn2r10 T C 5: 109,143,782 (GRCm39) M723V probably benign Het
Xndc1 T C 7: 101,728,031 (GRCm39) V14A possibly damaging Het
Xpnpep1 A G 19: 52,986,294 (GRCm39) probably benign Het
Yes1 T A 5: 32,812,862 (GRCm39) M322K possibly damaging Het
Zdhhc14 C A 17: 5,543,877 (GRCm39) N52K probably benign Het
Zfp42 A G 8: 43,749,015 (GRCm39) V162A probably benign Het
Other mutations in Tulp2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00093:Tulp2 APN 7 45,171,332 (GRCm39) missense probably damaging 1.00
IGL00942:Tulp2 APN 7 45,165,692 (GRCm39) missense possibly damaging 0.87
IGL01881:Tulp2 APN 7 45,170,219 (GRCm39) missense probably damaging 1.00
IGL03240:Tulp2 APN 7 45,171,734 (GRCm39) missense probably damaging 1.00
IGL03242:Tulp2 APN 7 45,171,282 (GRCm39) missense probably damaging 0.99
IGL03353:Tulp2 APN 7 45,165,696 (GRCm39) missense probably damaging 1.00
R0063:Tulp2 UTSW 7 45,170,284 (GRCm39) unclassified probably benign
R0063:Tulp2 UTSW 7 45,170,284 (GRCm39) unclassified probably benign
R0306:Tulp2 UTSW 7 45,168,000 (GRCm39) unclassified probably benign
R0710:Tulp2 UTSW 7 45,170,232 (GRCm39) missense possibly damaging 0.92
R1168:Tulp2 UTSW 7 45,167,266 (GRCm39) missense probably benign
R1345:Tulp2 UTSW 7 45,168,145 (GRCm39) missense probably benign 0.13
R1737:Tulp2 UTSW 7 45,169,201 (GRCm39) missense probably damaging 1.00
R1854:Tulp2 UTSW 7 45,167,367 (GRCm39) missense probably damaging 0.98
R1918:Tulp2 UTSW 7 45,167,365 (GRCm39) missense possibly damaging 0.95
R2356:Tulp2 UTSW 7 45,168,052 (GRCm39) missense possibly damaging 0.85
R3012:Tulp2 UTSW 7 45,168,187 (GRCm39) missense probably damaging 1.00
R3419:Tulp2 UTSW 7 45,168,176 (GRCm39) missense possibly damaging 0.56
R4236:Tulp2 UTSW 7 45,171,298 (GRCm39) missense probably damaging 1.00
R4701:Tulp2 UTSW 7 45,167,348 (GRCm39) missense probably damaging 0.98
R5367:Tulp2 UTSW 7 45,166,075 (GRCm39) missense possibly damaging 0.95
R6056:Tulp2 UTSW 7 45,139,797 (GRCm39) splice site probably null
R6294:Tulp2 UTSW 7 45,164,116 (GRCm39) missense probably damaging 1.00
R6432:Tulp2 UTSW 7 45,168,012 (GRCm39) missense probably benign 0.01
R6875:Tulp2 UTSW 7 45,168,038 (GRCm39) missense probably benign 0.05
R7459:Tulp2 UTSW 7 45,169,227 (GRCm39) missense probably damaging 1.00
R7556:Tulp2 UTSW 7 45,168,005 (GRCm39) splice site probably null
R7676:Tulp2 UTSW 7 45,170,451 (GRCm39) missense possibly damaging 0.86
R7883:Tulp2 UTSW 7 45,166,188 (GRCm39) splice site probably null
R8775:Tulp2 UTSW 7 45,164,914 (GRCm39) missense probably benign
R8775-TAIL:Tulp2 UTSW 7 45,164,914 (GRCm39) missense probably benign
R8804:Tulp2 UTSW 7 45,170,398 (GRCm39) missense probably damaging 1.00
Z1088:Tulp2 UTSW 7 45,171,410 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGAAGCCTTCCATTCACTGGCTAAG -3'
(R):5'- GCCCACGTTGACTCTCTAAGAACC -3'

Sequencing Primer
(F):5'- TTCACTGGCTAAGCCACAC -3'
(R):5'- AACTCATCAGGCTTTAGTGCCAG -3'
Posted On 2013-07-11