Incidental Mutation 'R7391:Muc16'
ID573446
Institutional Source Beutler Lab
Gene Symbol Muc16
Ensembl Gene ENSMUSG00000109564
Gene Namemucin 16
Synonyms1110008I14Rik, LOC385009
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.200) question?
Stock #R7391 (G1)
Quality Score225.009
Status Not validated
Chromosome9
Chromosomal Location18495455-18674530 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 18639536 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 5154 (V5154I)
Ref Sequence ENSEMBL: ENSMUSP00000147104 (fasta)
Predicted Effect probably benign
Transcript: ENSMUST00000208663
AA Change: V5154I

PolyPhen 2 Score 0.044 (Sensitivity: 0.94; Specificity: 0.83)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype PHENOTYPE: Homozygous null mice are viable and fertile with no gross histological abnormalities. Homozygous male mice father larger litters when crossed to wild-type females. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arfgef3 A T 10: 18,646,259 I673K probably benign Het
Arhgap32 C A 9: 32,181,939 T196K probably benign Het
B3gnt2 A T 11: 22,836,482 C235* probably null Het
BC080695 T A 4: 143,572,306 L273H probably damaging Het
Capn5 C T 7: 98,131,219 V315M probably benign Het
Ccl24 T A 5: 135,570,822 R111S possibly damaging Het
Cdk9 A G 2: 32,712,071 V45A probably damaging Het
Cep162 G T 9: 87,248,494 S21* probably null Het
Chil3 T A 3: 106,164,180 Y56F probably damaging Het
Ctr9 T A 7: 111,043,171 L368* probably null Het
Ctss A G 3: 95,529,541 E45G probably benign Het
Cyp2c29 A T 19: 39,307,767 Q214L probably null Het
Cyp2d34 T A 15: 82,618,386 N183I probably benign Het
Dhx29 T A 13: 112,962,859 N1139K probably benign Het
Ermp1 C A 19: 29,627,068 probably null Het
Ermp1 T A 19: 29,627,069 probably null Het
Evi2 A G 11: 79,515,667 S361P probably benign Het
Ext2 T A 2: 93,730,267 K518M probably damaging Het
Fgl1 A C 8: 41,210,446 M15R probably benign Het
Fsip2 T G 2: 82,990,319 D5465E possibly damaging Het
Hdlbp A T 1: 93,431,061 I256N possibly damaging Het
Hnrnpu T C 1: 178,337,078 Q165R unknown Het
Homer3 G A 8: 70,289,484 A132T probably benign Het
Ikbkap C A 4: 56,781,211 Q487H possibly damaging Het
Ikbkap T G 4: 56,781,212 Q487P probably benign Het
Kcnb1 T C 2: 167,105,450 R493G probably damaging Het
Kcnn3 A T 3: 89,609,471 T396S probably benign Het
Krt15 A T 11: 100,135,560 V100E possibly damaging Het
Krtap4-1 A G 11: 99,627,984 S67P unknown Het
Lama4 G T 10: 39,087,387 probably null Het
Lrrtm2 T A 18: 35,212,765 I495F possibly damaging Het
Mical2 A T 7: 112,320,609 E442V probably damaging Het
Nav3 A T 10: 109,703,456 M2028K probably benign Het
Ncr1 T A 7: 4,344,471 W249R possibly damaging Het
Neurod6 T C 6: 55,679,631 D7G probably damaging Het
Nwd1 A G 8: 72,662,418 E158G probably damaging Het
Olfr132 A T 17: 38,131,050 F47L probably benign Het
Olfr1328 A T 4: 118,934,001 N282K possibly damaging Het
Olfr1381 T C 11: 49,552,544 S266P probably damaging Het
Olfr1395 A G 11: 49,148,979 T241A probably damaging Het
Olfr33 T C 7: 102,713,982 N144D probably benign Het
Padi2 A G 4: 140,937,955 D457G probably benign Het
Pcdh1 C T 18: 38,202,785 E266K possibly damaging Het
Pigr A G 1: 130,849,566 D703G probably damaging Het
Ppm1f T A 16: 16,914,234 S183T probably benign Het
Ppp2r5b T A 19: 6,228,514 Q455L probably benign Het
Ptpn13 C T 5: 103,540,981 S880L probably damaging Het
R3hdm4 T C 10: 79,911,109 K240R probably benign Het
Rin1 T C 19: 5,050,860 M1T probably null Het
Rundc3b T A 5: 8,559,455 M170L probably benign Het
Ryr3 A T 2: 112,780,977 probably null Het
Scn11a T C 9: 119,795,717 D513G probably damaging Het
Slc27a2 C A 2: 126,553,162 P3Q unknown Het
Slc4a8 A G 15: 100,784,862 I187M probably damaging Het
Slc6a11 A T 6: 114,238,461 I441F probably benign Het
Stx2 C T 5: 128,988,803 R263Q probably damaging Het
Svep1 A T 4: 58,145,185 W427R probably damaging Het
Tes T A 6: 17,096,167 H51Q probably damaging Het
Thnsl2 T C 6: 71,131,930 D299G probably damaging Het
Tmem30b T C 12: 73,545,928 S138G probably benign Het
Tmprss11c T A 5: 86,237,791 H274L probably damaging Het
Trim10 G A 17: 36,869,881 M1I probably null Het
Ttc30a1 T C 2: 75,980,015 K575E probably benign Het
Unc13b A G 4: 43,216,459 I253V probably benign Het
Unc80 A G 1: 66,695,528 S3305G probably benign Het
Ush2a TCACC TC 1: 188,962,008 probably benign Het
Virma A G 4: 11,508,099 D267G probably damaging Het
Vmn1r46 C T 6: 89,976,625 S152L probably benign Het
Wdr90 T C 17: 25,846,528 N1621S probably benign Het
Zfhx3 G A 8: 108,947,843 A1842T probably damaging Het
Zfp583 A G 7: 6,316,499 S505P probably damaging Het
Zfp608 T C 18: 54,897,547 Y1107C possibly damaging Het
Zfp616 A G 11: 74,085,329 H808R probably benign Het
Zfp677 T C 17: 21,398,391 F570S possibly damaging Het
Zfp85 A T 13: 67,749,291 Y221N probably damaging Het
Other mutations in Muc16
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01330:Muc16 APN 9 18508507 missense possibly damaging 0.89
IGL01878:Muc16 APN 9 18495543 missense possibly damaging 0.90
IGL02394:Muc16 APN 9 18498700 missense probably damaging 0.99
IGL02553:Muc16 APN 9 18498553 critical splice donor site probably null
R0400:Muc16 UTSW 9 18510534 missense possibly damaging 0.74
R1620:Muc16 UTSW 9 18510477 missense possibly damaging 0.89
R1695:Muc16 UTSW 9 18497433 missense probably damaging 1.00
R3196:Muc16 UTSW 9 18497830 missense probably damaging 1.00
R5982:Muc16 UTSW 9 18647146 missense unknown
R5990:Muc16 UTSW 9 18659243 missense unknown
R6024:Muc16 UTSW 9 18646671 missense unknown
R6026:Muc16 UTSW 9 18659858 missense unknown
R6028:Muc16 UTSW 9 18657176 missense unknown
R6083:Muc16 UTSW 9 18657212 missense unknown
R6089:Muc16 UTSW 9 18643252 missense unknown
R6109:Muc16 UTSW 9 18655359 missense unknown
R6127:Muc16 UTSW 9 18657878 missense unknown
R6130:Muc16 UTSW 9 18590698 missense probably damaging 1.00
R6146:Muc16 UTSW 9 18497797 missense probably damaging 0.98
R6161:Muc16 UTSW 9 18647818 missense unknown
R6164:Muc16 UTSW 9 18558379 missense probably damaging 1.00
R6185:Muc16 UTSW 9 18654473 missense unknown
R6192:Muc16 UTSW 9 18658689 missense unknown
R6217:Muc16 UTSW 9 18655446 missense unknown
R6232:Muc16 UTSW 9 18656998 missense unknown
R6246:Muc16 UTSW 9 18577067 intron probably null
R6255:Muc16 UTSW 9 18655599 missense unknown
R6280:Muc16 UTSW 9 18579317 critical splice donor site probably null
R6286:Muc16 UTSW 9 18644389 missense unknown
R6287:Muc16 UTSW 9 18659034 missense unknown
R6307:Muc16 UTSW 9 18647588 missense unknown
R6310:Muc16 UTSW 9 18641950 missense probably benign 0.00
R6316:Muc16 UTSW 9 18641819 missense probably benign 0.01
R6335:Muc16 UTSW 9 18660708 missense unknown
R6345:Muc16 UTSW 9 18654926 missense unknown
R6349:Muc16 UTSW 9 18657329 missense unknown
R6366:Muc16 UTSW 9 18646044 missense unknown
R6393:Muc16 UTSW 9 18647399 nonsense probably null
R6440:Muc16 UTSW 9 18641359 missense probably benign 0.01
R6458:Muc16 UTSW 9 18641721 missense probably benign 0.01
R6460:Muc16 UTSW 9 18640516 missense probably benign 0.01
R6481:Muc16 UTSW 9 18550677 critical splice donor site probably null
R6539:Muc16 UTSW 9 18637325 missense probably benign 0.25
R6551:Muc16 UTSW 9 18562562 missense possibly damaging 0.95
R6596:Muc16 UTSW 9 18566715 missense probably benign 0.18
R6601:Muc16 UTSW 9 18637570 missense probably benign 0.10
R6602:Muc16 UTSW 9 18609476 intron probably null
R6615:Muc16 UTSW 9 18647188 missense unknown
R6625:Muc16 UTSW 9 18660278 missense unknown
R6668:Muc16 UTSW 9 18640385 missense probably benign 0.03
R6697:Muc16 UTSW 9 18641291 missense probably benign 0.01
R6710:Muc16 UTSW 9 18642070 missense possibly damaging 0.95
R6727:Muc16 UTSW 9 18566690 critical splice donor site probably null
R6789:Muc16 UTSW 9 18559986 missense probably benign 0.40
R6806:Muc16 UTSW 9 18537910 critical splice donor site probably null
R6874:Muc16 UTSW 9 18658769 nonsense probably null
R6894:Muc16 UTSW 9 18495576 missense possibly damaging 0.92
R6913:Muc16 UTSW 9 18642663 missense unknown
R6919:Muc16 UTSW 9 18660299 missense unknown
R6939:Muc16 UTSW 9 18638537 missense probably benign 0.04
R6953:Muc16 UTSW 9 18640529 missense probably benign 0.01
R6956:Muc16 UTSW 9 18645026 missense unknown
R6977:Muc16 UTSW 9 18645337 missense unknown
R6996:Muc16 UTSW 9 18645897 missense unknown
R7011:Muc16 UTSW 9 18637451 missense probably benign 0.26
R7011:Muc16 UTSW 9 18637543 missense probably benign 0.10
R7012:Muc16 UTSW 9 18495618 critical splice acceptor site probably null
R7014:Muc16 UTSW 9 18658236 missense unknown
R7021:Muc16 UTSW 9 18554919 missense unknown
R7021:Muc16 UTSW 9 18550831 splice site probably null
R7038:Muc16 UTSW 9 18620468 missense probably damaging 0.99
R7057:Muc16 UTSW 9 18646079 missense unknown
R7058:Muc16 UTSW 9 18639755 missense probably benign 0.10
R7066:Muc16 UTSW 9 18658021 missense unknown
R7067:Muc16 UTSW 9 18658251 missense unknown
R7070:Muc16 UTSW 9 18645923 nonsense probably null
R7074:Muc16 UTSW 9 18655650 missense unknown
R7085:Muc16 UTSW 9 18644849 missense unknown
R7088:Muc16 UTSW 9 18592680 missense probably damaging 0.99
R7107:Muc16 UTSW 9 18637298 missense probably benign 0.10
R7108:Muc16 UTSW 9 18655233 missense unknown
R7126:Muc16 UTSW 9 18641216 missense probably benign 0.01
R7128:Muc16 UTSW 9 18643004 missense unknown
R7145:Muc16 UTSW 9 18655580 missense unknown
R7179:Muc16 UTSW 9 18642008 missense probably benign 0.00
R7194:Muc16 UTSW 9 18674454 missense unknown
R7211:Muc16 UTSW 9 18498570 missense probably damaging 1.00
R7213:Muc16 UTSW 9 18641416 missense probably benign 0.01
R7217:Muc16 UTSW 9 18644076 nonsense probably null
R7221:Muc16 UTSW 9 18642199 missense probably benign 0.04
R7265:Muc16 UTSW 9 18656472 missense unknown
R7326:Muc16 UTSW 9 18585013 missense probably benign 0.03
R7359:Muc16 UTSW 9 18643020 missense unknown
R7387:Muc16 UTSW 9 18641720 missense probably benign 0.01
R7398:Muc16 UTSW 9 18637742 missense possibly damaging 0.46
R7419:Muc16 UTSW 9 18641962 missense probably benign 0.01
R7431:Muc16 UTSW 9 18607993 missense
R7484:Muc16 UTSW 9 18646768 missense unknown
R7487:Muc16 UTSW 9 18584799 missense possibly damaging 0.93
R7497:Muc16 UTSW 9 18645089 missense unknown
R7515:Muc16 UTSW 9 18639662 missense probably benign 0.00
R7537:Muc16 UTSW 9 18638135 missense probably benign 0.06
R7538:Muc16 UTSW 9 18642131 missense probably benign 0.10
R7538:Muc16 UTSW 9 18655451 missense unknown
R7543:Muc16 UTSW 9 18644732 missense unknown
R7566:Muc16 UTSW 9 18638629 missense probably benign 0.00
R7581:Muc16 UTSW 9 18645614 missense unknown
R7594:Muc16 UTSW 9 18645062 missense unknown
R7629:Muc16 UTSW 9 18566785 missense possibly damaging 0.86
R7664:Muc16 UTSW 9 18607722 missense probably benign 0.08
R7666:Muc16 UTSW 9 18558427 missense probably damaging 1.00
R7703:Muc16 UTSW 9 18605282 missense
R7727:Muc16 UTSW 9 18660242 missense unknown
Predicted Primers PCR Primer
(F):5'- ATCAACTCTGGAGCACTGGTTG -3'
(R):5'- AACTTTGCCTGCTTCACCAG -3'

Sequencing Primer
(F):5'- TTCCAGTTTGGGCAGACC -3'
(R):5'- TGCTTCACCAGGTCAAGCAG -3'
Posted On2019-09-13