Mutagenetix > Incidental Mutations

Incidental Mutation 'R7391:Nav3'

573453

Institutional Source

Beutler Lab

Gene Symbol

Nav3

Ensembl Gene

ENSMUSG00000020181

Gene Name

neuron navigator 3

Synonyms

POMFIL1, 9630020C08Rik, 4732483H20Rik, unc53H3, steerin 3, Pomfil1p

MMRRC Submission

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R7391 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

109681259-110456204 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 109703456 bp

Zygosity

Heterozygous

Amino Acid Change

Methionine to Lysine at position 2028 (M2028K)

Ref Sequence

ENSEMBL: ENSMUSP00000032719 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000032719]

Predicted Effect

probably benign
Transcript: ENSMUST00000032719
AA Change: M2028K

PolyPhen 2 Score 0.074 (Sensitivity: 0.93; Specificity: 0.85)

SMART Domains

Protein: ENSMUSP00000032719
Gene: ENSMUSG00000020181
AA Change: M2028K

Domain	Start	End	E-Value	Type
CH	79	182	4.41e-12	SMART
low complexity region	184	194	N/A	INTRINSIC
low complexity region	318	329	N/A	INTRINSIC
low complexity region	353	363	N/A	INTRINSIC
low complexity region	427	439	N/A	INTRINSIC
low complexity region	522	536	N/A	INTRINSIC
low complexity region	713	724	N/A	INTRINSIC
low complexity region	807	818	N/A	INTRINSIC
low complexity region	873	896	N/A	INTRINSIC
low complexity region	904	916	N/A	INTRINSIC
low complexity region	1077	1095	N/A	INTRINSIC
low complexity region	1160	1173	N/A	INTRINSIC
low complexity region	1207	1229	N/A	INTRINSIC
low complexity region	1256	1266	N/A	INTRINSIC
low complexity region	1274	1285	N/A	INTRINSIC
low complexity region	1293	1312	N/A	INTRINSIC
low complexity region	1327	1341	N/A	INTRINSIC
low complexity region	1383	1397	N/A	INTRINSIC
low complexity region	1462	1474	N/A	INTRINSIC
low complexity region	1550	1563	N/A	INTRINSIC
coiled coil region	1565	1656	N/A	INTRINSIC
low complexity region	1675	1692	N/A	INTRINSIC
low complexity region	1722	1733	N/A	INTRINSIC
low complexity region	1756	1781	N/A	INTRINSIC
low complexity region	1782	1795	N/A	INTRINSIC
coiled coil region	1801	1842	N/A	INTRINSIC
low complexity region	1848	1871	N/A	INTRINSIC
AAA	2029	2184	4.94e-7	SMART

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 98.9%

Validation Efficiency

99% (79/80)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the neuron navigator family and is expressed predominantly in the nervous system. The encoded protein contains coiled-coil domains and a conserved AAA domain characteristic for ATPases associated with a variety of cellular activities. This gene is similar to unc-53, a Caenorhabditis elegans gene involved in axon guidance. Multiple alternatively spliced transcript variants for this gene have been described but only one has had its full-length nature determined. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 78 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Arfgef3	A	T	10: 18,646,259	I673K	probably benign	Het
Arhgap32	C	A	9: 32,181,939	T196K	probably benign	Het
Azi2	T	A	9: 118,050,892		probably null	Het
B3gnt2	A	T	11: 22,836,482	C235*	probably null	Het
BC080695	T	A	4: 143,572,306	L273H	probably damaging	Het
Capn5	C	T	7: 98,131,219	V315M	probably benign	Het
Ccl24	T	A	5: 135,570,822	R111S	possibly damaging	Het
Cdk9	A	G	2: 32,712,071	V45A	probably damaging	Het
Cep162	G	T	9: 87,248,494	S21*	probably null	Het
Chil3	T	A	3: 106,164,180	Y56F	probably damaging	Het
Ctr9	T	A	7: 111,043,171	L368*	probably null	Het
Ctss	A	G	3: 95,529,541	E45G	probably benign	Het
Cyp2c29	A	T	19: 39,307,767	Q214L	probably null	Het
Cyp2d34	T	A	15: 82,618,386	N183I	probably benign	Het
Dhx29	T	A	13: 112,962,859	N1139K	probably benign	Het
Ermp1	C	A	19: 29,627,068		probably null	Het
Ermp1	T	A	19: 29,627,069		probably null	Het
Evi2	A	G	11: 79,515,667	S361P	probably benign	Het
Ext2	T	A	2: 93,730,267	K518M	probably damaging	Het
Fgl1	A	C	8: 41,210,446	M15R	probably benign	Het
Fsip2	T	G	2: 82,990,319	D5465E	possibly damaging	Het
Hdlbp	A	T	1: 93,431,061	I256N	possibly damaging	Het
Hmmr	G	T	11: 40,707,786		probably null	Het
Hnrnpu	T	C	1: 178,337,078	Q165R	unknown	Het
Homer3	G	A	8: 70,289,484	A132T	probably benign	Het
Ikbkap	C	A	4: 56,781,211	Q487H	possibly damaging	Het
Ikbkap	T	G	4: 56,781,212	Q487P	probably benign	Het
Kcnb1	T	C	2: 167,105,450	R493G	probably damaging	Het
Kcnn3	A	T	3: 89,609,471	T396S	probably benign	Het
Krt15	A	T	11: 100,135,560	V100E	possibly damaging	Het
Krtap4-1	A	G	11: 99,627,984	S67P	unknown	Het
Lama4	G	T	10: 39,087,387		probably null	Het
Lrrtm2	T	A	18: 35,212,765	I495F	possibly damaging	Het
Mical2	A	T	7: 112,320,609	E442V	probably damaging	Het
Muc16	C	T	9: 18,639,536	V5154I	probably benign	Het
Ncr1	T	A	7: 4,344,471	W249R	possibly damaging	Het
Neurod6	T	C	6: 55,679,631	D7G	probably damaging	Het
Nwd1	A	G	8: 72,662,418	E158G	probably damaging	Het
Olfr132	A	T	17: 38,131,050	F47L	probably benign	Het
Olfr1328	A	T	4: 118,934,001	N282K	possibly damaging	Het
Olfr1381	T	C	11: 49,552,544	S266P	probably damaging	Het
Olfr1395	A	G	11: 49,148,979	T241A	probably damaging	Het
Olfr33	T	C	7: 102,713,982	N144D	probably benign	Het
Padi2	A	G	4: 140,937,955	D457G	probably benign	Het
Parn	C	A	16: 13,668,006		probably null	Het
Pcdh1	C	T	18: 38,202,785	E266K	possibly damaging	Het
Pigr	A	G	1: 130,849,566	D703G	probably damaging	Het
Ppm1f	T	A	16: 16,914,234	S183T	probably benign	Het
Ppp2r5b	T	A	19: 6,228,514	Q455L	probably benign	Het
Ptpn13	C	T	5: 103,540,981	S880L	probably damaging	Het
R3hdm4	T	C	10: 79,911,109	K240R	probably benign	Het
Rin1	T	C	19: 5,050,860	M1T	probably null	Het
Rundc3b	T	A	5: 8,559,455	M170L	probably benign	Het
Ryr3	A	T	2: 112,780,977		probably null	Het
Scn11a	T	C	9: 119,795,717	D513G	probably damaging	Het
Slc27a2	C	A	2: 126,553,162	P3Q	unknown	Het
Slc4a8	A	G	15: 100,784,862	I187M	probably damaging	Het
Slc6a11	A	T	6: 114,238,461	I441F	probably benign	Het
Stx2	C	T	5: 128,988,803	R263Q	probably damaging	Het
Svep1	A	T	4: 58,145,185	W427R	probably damaging	Het
Tes	T	A	6: 17,096,167	H51Q	probably damaging	Het
Thnsl2	T	C	6: 71,131,930	D299G	probably damaging	Het
Tmem30b	T	C	12: 73,545,928	S138G	probably benign	Het
Tmprss11c	T	A	5: 86,237,791	H274L	probably damaging	Het
Trim10	G	A	17: 36,869,881	M1I	probably null	Het
Ttc30a1	T	C	2: 75,980,015	K575E	probably benign	Het
Unc13b	A	G	4: 43,216,459	I253V	probably benign	Het
Unc80	A	G	1: 66,695,528	S3305G	probably benign	Het
Ush2a	TCACC	TC	1: 188,962,008		probably benign	Het
Virma	A	G	4: 11,508,099	D267G	probably damaging	Het
Vmn1r46	C	T	6: 89,976,625	S152L	probably benign	Het
Wdr90	T	C	17: 25,846,528	N1621S	probably benign	Het
Zfhx3	G	A	8: 108,947,843	A1842T	probably damaging	Het
Zfp583	A	G	7: 6,316,499	S505P	probably damaging	Het
Zfp608	T	C	18: 54,897,547	Y1107C	possibly damaging	Het
Zfp616	A	G	11: 74,085,329	H808R	probably benign	Het
Zfp677	T	C	17: 21,398,391	F570S	possibly damaging	Het
Zfp85	A	T	13: 67,749,291	Y221N	probably damaging	Het

Other mutations in Nav3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00095:Nav3	APN	10	109841733	missense	probably damaging	0.99
IGL00425:Nav3	APN	10	109703507	missense	probably benign	0.13
IGL00465:Nav3	APN	10	109852746	missense	probably damaging	0.99
IGL00531:Nav3	APN	10	109703310	missense	probably null	0.99
IGL00575:Nav3	APN	10	109764765	missense	probably damaging	0.98
IGL00770:Nav3	APN	10	109816263	missense	probably damaging	1.00
IGL00774:Nav3	APN	10	109816263	missense	probably damaging	1.00
IGL00858:Nav3	APN	10	109742632	missense	probably damaging	0.98
IGL00935:Nav3	APN	10	109705666	missense	probably benign
IGL01638:Nav3	APN	10	109852863	missense	probably damaging	1.00
IGL01662:Nav3	APN	10	109769258	missense	possibly damaging	0.56
IGL01670:Nav3	APN	10	109714241	missense	possibly damaging	0.92
IGL01885:Nav3	APN	10	109742660	nonsense	probably null
IGL01979:Nav3	APN	10	109704929	missense	probably benign	0.01
IGL02121:Nav3	APN	10	109759036	missense	probably damaging	0.99
IGL02210:Nav3	APN	10	109766990	missense	probably benign
IGL02523:Nav3	APN	10	109769296	missense	probably damaging	1.00
IGL02573:Nav3	APN	10	109866974	missense	probably benign	0.23
IGL02633:Nav3	APN	10	109692136	missense	probably benign	0.09
IGL02810:Nav3	APN	10	109816274	missense	probably damaging	1.00
IGL02964:Nav3	APN	10	109736953	missense	probably damaging	0.99
IGL03015:Nav3	APN	10	109718297	missense	probably damaging	0.98
IGL03288:Nav3	APN	10	109759017	missense	probably damaging	1.00
IGL03310:Nav3	APN	10	109824572	critical splice donor site	probably null
PIT4377001:Nav3	UTSW	10	109716605	missense	probably damaging	0.99
R0010:Nav3	UTSW	10	109823226	splice site	probably benign
R0043:Nav3	UTSW	10	109767518	missense	possibly damaging	0.95
R0053:Nav3	UTSW	10	109766917	splice site	probably benign
R0053:Nav3	UTSW	10	109766917	splice site	probably benign
R0077:Nav3	UTSW	10	109716642	missense	possibly damaging	0.87
R0219:Nav3	UTSW	10	109866930	critical splice donor site	probably null
R0310:Nav3	UTSW	10	109767128	missense	possibly damaging	0.82
R0380:Nav3	UTSW	10	109758879	splice site	probably benign
R0403:Nav3	UTSW	10	109767103	missense	probably damaging	0.98
R0480:Nav3	UTSW	10	109853300	missense	probably damaging	1.00
R0626:Nav3	UTSW	10	109823464	missense	probably damaging	1.00
R0637:Nav3	UTSW	10	109770197	missense	probably benign	0.25
R0847:Nav3	UTSW	10	109903857	missense	possibly damaging	0.94
R0988:Nav3	UTSW	10	109716528	missense	probably damaging	1.00
R1272:Nav3	UTSW	10	109736999	missense	probably damaging	0.98
R1295:Nav3	UTSW	10	109692102	missense	probably damaging	1.00
R1405:Nav3	UTSW	10	109770333	splice site	probably benign
R1406:Nav3	UTSW	10	109883634	missense	possibly damaging	0.64
R1406:Nav3	UTSW	10	109883634	missense	possibly damaging	0.64
R1420:Nav3	UTSW	10	109823254	missense	probably benign	0.02
R1449:Nav3	UTSW	10	109853511	missense	probably benign	0.13
R1458:Nav3	UTSW	10	109720044	missense	probably damaging	1.00
R1469:Nav3	UTSW	10	109760508	missense	probably damaging	1.00
R1469:Nav3	UTSW	10	109760508	missense	probably damaging	1.00
R1472:Nav3	UTSW	10	109727941	missense	probably damaging	0.99
R1537:Nav3	UTSW	10	109866985	missense	probably damaging	1.00
R1539:Nav3	UTSW	10	109767170	missense	probably damaging	0.99
R1581:Nav3	UTSW	10	109823428	missense	probably damaging	1.00
R1586:Nav3	UTSW	10	109853254	missense	probably damaging	1.00
R1654:Nav3	UTSW	10	109853123	missense	possibly damaging	0.85
R1725:Nav3	UTSW	10	109823590	missense	probably damaging	1.00
R1742:Nav3	UTSW	10	109769213	missense	probably benign
R1793:Nav3	UTSW	10	109703372	missense	probably benign	0.00
R1830:Nav3	UTSW	10	109823323	missense	probably damaging	1.00
R1834:Nav3	UTSW	10	109720022	missense	probably damaging	0.99
R1881:Nav3	UTSW	10	109852559	missense	probably damaging	0.96
R1922:Nav3	UTSW	10	109705606	missense	probably benign	0.43
R1944:Nav3	UTSW	10	109716530	missense	probably damaging	0.99
R1981:Nav3	UTSW	10	109719090	splice site	probably benign
R1985:Nav3	UTSW	10	109770184	splice site	probably benign
R1996:Nav3	UTSW	10	109853401	missense	probably damaging	1.00
R2051:Nav3	UTSW	10	109824675	missense	probably damaging	0.99
R2062:Nav3	UTSW	10	109720021	missense	probably damaging	1.00
R2139:Nav3	UTSW	10	109853135	missense	probably benign	0.22
R2248:Nav3	UTSW	10	109696227	missense	probably damaging	1.00
R2420:Nav3	UTSW	10	109863813	missense	probably damaging	0.98
R2444:Nav3	UTSW	10	109764915	missense	probably benign	0.09
R3026:Nav3	UTSW	10	109824604	missense	probably damaging	0.99
R3052:Nav3	UTSW	10	109903752	missense	probably damaging	0.99
R3441:Nav3	UTSW	10	109704928	missense	probably benign	0.01
R3845:Nav3	UTSW	10	109853376	missense	possibly damaging	0.82
R3929:Nav3	UTSW	10	109684203	missense	probably damaging	1.00
R3932:Nav3	UTSW	10	109694035	missense	probably damaging	0.99
R4056:Nav3	UTSW	10	109880533	critical splice donor site	probably null
R4057:Nav3	UTSW	10	109880533	critical splice donor site	probably null
R4120:Nav3	UTSW	10	109903744	critical splice donor site	probably null
R4244:Nav3	UTSW	10	109769296	missense	probably damaging	1.00
R4361:Nav3	UTSW	10	109852986	missense	probably damaging	1.00
R4512:Nav3	UTSW	10	109694082	missense	possibly damaging	0.89
R4514:Nav3	UTSW	10	109694082	missense	possibly damaging	0.89
R4700:Nav3	UTSW	10	109764935	missense	probably benign	0.10
R4815:Nav3	UTSW	10	109823552	missense	probably benign
R4981:Nav3	UTSW	10	109880692	missense	probably benign
R5042:Nav3	UTSW	10	109769268	missense	probably benign	0.27
R5251:Nav3	UTSW	10	109853253	missense	probably damaging	0.99
R5252:Nav3	UTSW	10	109714291	small deletion	probably benign
R5273:Nav3	UTSW	10	109693038	critical splice donor site	probably null
R5288:Nav3	UTSW	10	109853105	missense	probably benign	0.10
R5407:Nav3	UTSW	10	109866935	missense	probably benign	0.28
R5533:Nav3	UTSW	10	109883678	missense	possibly damaging	0.61
R5561:Nav3	UTSW	10	109716552	missense	probably damaging	1.00
R5577:Nav3	UTSW	10	109769403	missense	probably damaging	1.00
R5656:Nav3	UTSW	10	109764633	missense	probably damaging	0.96
R5872:Nav3	UTSW	10	109764787	missense	probably damaging	1.00
R6023:Nav3	UTSW	10	109823515	missense	possibly damaging	0.95
R6061:Nav3	UTSW	10	109866984	nonsense	probably null
R6189:Nav3	UTSW	10	109720019	missense	probably damaging	0.98
R6214:Nav3	UTSW	10	109852565	missense	probably damaging	1.00
R6215:Nav3	UTSW	10	109852565	missense	probably damaging	1.00
R6264:Nav3	UTSW	10	109688833	missense	probably damaging	0.97
R6500:Nav3	UTSW	10	109764756	missense	probably damaging	1.00
R6524:Nav3	UTSW	10	109720030	missense	probably damaging	0.99
R6868:Nav3	UTSW	10	109693166	missense	possibly damaging	0.49
R7079:Nav3	UTSW	10	109767292	missense	probably benign	0.16
R7099:Nav3	UTSW	10	109703334	missense	probably benign	0.11
R7139:Nav3	UTSW	10	109853477	missense	probably benign	0.44
R7238:Nav3	UTSW	10	109853324	missense	possibly damaging	0.75
R7338:Nav3	UTSW	10	109769212	missense	probably benign	0.04
R7343:Nav3	UTSW	10	109903758	missense	probably damaging	0.98
R7383:Nav3	UTSW	10	109716671	missense	probably damaging	0.98
R7399:Nav3	UTSW	10	109852934	missense	possibly damaging	0.74
R7457:Nav3	UTSW	10	109696328	nonsense	probably null
R7462:Nav3	UTSW	10	109823578	missense	probably damaging	1.00
R7542:Nav3	UTSW	10	109823533	missense	possibly damaging	0.89
R7659:Nav3	UTSW	10	109766990	missense	probably benign	0.09
R7749:Nav3	UTSW	10	109703352	missense	probably damaging	0.99
R7794:Nav3	UTSW	10	109688856	missense	probably benign	0.08
R7876:Nav3	UTSW	10	109853498	missense	probably benign	0.26
R8048:Nav3	UTSW	10	109764918	missense	probably benign	0.13
R8104:Nav3	UTSW	10	109758967	missense	probably damaging	0.99
R8125:Nav3	UTSW	10	109852659	missense	probably damaging	0.99
R8275:Nav3	UTSW	10	109692123	missense	noncoding transcript
R8325:Nav3	UTSW	10	109705603	missense	probably benign	0.24
R8336:Nav3	UTSW	10	109767569	missense	probably damaging	0.99
R8523:Nav3	UTSW	10	109823277	missense	probably damaging	1.00
R8529:Nav3	UTSW	10	109853331	missense	probably benign	0.09
X0012:Nav3	UTSW	10	109692097	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TGACTGTTTGTAAAAGCAGCC -3'
(R):5'- TATGCAGCCGACAGTGAAGG -3'

Sequencing Primer
(F):5'- TGTAAAAGCAGCCTTTGTATGC -3'
(R):5'- GAGCTACATTTTTATGACTCACGAGG -3'

Posted On

2019-09-13