Incidental Mutation 'R7392:Dnah7a'
ID 573480
Institutional Source Beutler Lab
Gene Symbol Dnah7a
Ensembl Gene ENSMUSG00000096141
Gene Name dynein, axonemal, heavy chain 7A
Synonyms Dnahc7a, Dnahc7, LOC381341
MMRRC Submission 045474-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.104) question?
Stock # R7392 (G1)
Quality Score 225.009
Status Not validated
Chromosome 1
Chromosomal Location 53397006-53706784 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 53501661 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Glycine at position 2518 (E2518G)
Ref Sequence ENSEMBL: ENSMUSP00000092571 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000094964]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000094964
AA Change: E2518G

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000092571
Gene: ENSMUSG00000096141
AA Change: E2518G

DomainStartEndE-ValueType
low complexity region 2 15 N/A INTRINSIC
coiled coil region 504 537 N/A INTRINSIC
Pfam:DHC_N2 756 1165 3.1e-149 PFAM
AAA 1320 1459 2.46e-1 SMART
Blast:AAA 1601 1879 1e-87 BLAST
AAA 1968 2116 5.39e-2 SMART
Pfam:AAA_8 2303 2574 6.9e-75 PFAM
Pfam:MT 2586 2936 2.1e-55 PFAM
Pfam:AAA_9 2957 3182 1.3e-98 PFAM
Pfam:Dynein_heavy 3318 4020 2.3e-287 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 83 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610021A01Rik T A 7: 41,626,566 (GRCm38) F564L probably damaging Het
4930539E08Rik A T 17: 28,908,377 (GRCm38) D219E probably benign Het
9530053A07Rik C T 7: 28,164,372 (GRCm38) T2523M possibly damaging Het
Abcc2 T C 19: 43,808,687 (GRCm38) I499T probably damaging Het
Adamts13 C T 2: 26,989,324 (GRCm38) R630C probably damaging Het
Adgrv1 A T 13: 81,560,689 (GRCm38) F1199I probably damaging Het
Agbl5 G A 5: 30,890,771 (GRCm38) probably null Het
Anks1b A G 10: 90,680,786 (GRCm38) D881G possibly damaging Het
Arap2 A T 5: 62,698,385 (GRCm38) S569R possibly damaging Het
Arhgap15 T C 2: 44,063,774 (GRCm38) S171P possibly damaging Het
Arhgef11 G A 3: 87,717,175 (GRCm38) probably null Het
Baz1a C A 12: 54,898,765 (GRCm38) L1271F probably damaging Het
Bdnf A C 2: 109,723,930 (GRCm38) K216N probably benign Het
Bmp7 C T 2: 172,870,205 (GRCm38) D409N probably damaging Het
Cacna1c T A 6: 118,741,920 (GRCm38) I390F Het
Chd8 A G 14: 52,232,855 (GRCm38) S433P probably benign Het
Clrn2 A G 5: 45,463,909 (GRCm38) E215G possibly damaging Het
Col19a1 T G 1: 24,534,034 (GRCm38) D219A unknown Het
Col2a1 G A 15: 97,980,151 (GRCm38) R1036* probably null Het
Copg1 T A 6: 87,890,275 (GRCm38) V110D probably benign Het
Cpd C T 11: 76,801,779 (GRCm38) G744D probably damaging Het
Crygs G A 16: 22,806,502 (GRCm38) P63L probably benign Het
Dcn A G 10: 97,509,998 (GRCm38) D224G probably damaging Het
Efcab6 C A 15: 83,988,951 (GRCm38) R197L probably benign Het
Efr3b T A 12: 3,969,588 (GRCm38) Y723F probably benign Het
Enam A G 5: 88,501,664 (GRCm38) N344S probably damaging Het
Erich4 A G 7: 25,615,676 (GRCm38) I58T possibly damaging Het
Esrp1 A G 4: 11,338,809 (GRCm38) V665A probably benign Het
Etf1 G A 18: 34,906,050 (GRCm38) T388I probably benign Het
Faf1 A G 4: 109,794,843 (GRCm38) T244A probably benign Het
Fam129a A G 1: 151,696,224 (GRCm38) T307A probably damaging Het
Fbn1 T C 2: 125,343,924 (GRCm38) D1610G probably damaging Het
Frem1 G T 4: 83,013,827 (GRCm38) F212L probably benign Het
Fuom T A 7: 140,101,160 (GRCm38) D85V probably damaging Het
Gcfc2 T C 6: 81,943,012 (GRCm38) probably null Het
Gpr37 C T 6: 25,688,787 (GRCm38) A104T probably benign Het
Hsp90ab1 G C 17: 45,569,048 (GRCm38) T514S probably benign Het
Ifnl2 A G 7: 28,509,669 (GRCm38) F74L probably benign Het
Ipo11 G A 13: 106,891,691 (GRCm38) R367* probably null Het
Itpr2 T C 6: 146,359,340 (GRCm38) D963G possibly damaging Het
Krt15 A T 11: 100,135,560 (GRCm38) V100E possibly damaging Het
Lrch3 T A 16: 32,986,755 (GRCm38) L466* probably null Het
Lrfn5 A T 12: 61,840,304 (GRCm38) T293S probably benign Het
Lrp5 A G 19: 3,610,199 (GRCm38) I955T probably damaging Het
Lrrc4b C T 7: 44,462,015 (GRCm38) T437M probably damaging Het
Man1a A G 10: 53,919,187 (GRCm38) Y657H probably damaging Het
Mapkap1 G T 2: 34,435,154 (GRCm38) R94L probably damaging Het
Mtmr4 T A 11: 87,604,557 (GRCm38) L480Q probably damaging Het
Mycbp2 T C 14: 103,152,191 (GRCm38) I3504M probably damaging Het
Mycbp2 A T 14: 103,243,128 (GRCm38) C1169S probably damaging Het
Myo15 T C 11: 60,505,976 (GRCm38) S1455P Het
Nid2 A G 14: 19,768,656 (GRCm38) D406G probably benign Het
Nrip2 A G 6: 128,404,950 (GRCm38) I69V probably benign Het
Nthl1 G A 17: 24,638,624 (GRCm38) V266I probably benign Het
Olfr1000 A C 2: 85,608,488 (GRCm38) C141G possibly damaging Het
Olfr1061 A G 2: 86,413,152 (GRCm38) V300A probably benign Het
Olfr1440 G T 19: 12,394,465 (GRCm38) L67F probably damaging Het
Olfr1444 A G 19: 12,862,587 (GRCm38) T271A probably benign Het
Olfr284 A G 15: 98,340,311 (GRCm38) V226A probably benign Het
Olfr501-ps1 C A 7: 108,508,084 (GRCm38) H9Q possibly damaging Het
Olfr698 T C 7: 106,753,382 (GRCm38) E2G possibly damaging Het
Pcdhb1 A C 18: 37,265,118 (GRCm38) S41R possibly damaging Het
Pdcd11 T A 19: 47,127,997 (GRCm38) F1529I probably damaging Het
Plcd3 C A 11: 103,101,557 (GRCm38) probably benign Het
Qdpr T C 5: 45,439,376 (GRCm38) M149V probably benign Het
R3hcc1 T A 14: 69,705,880 (GRCm38) probably null Het
Rasgrf2 T C 13: 91,893,737 (GRCm38) Y392C Het
Slc8a3 A C 12: 81,314,803 (GRCm38) V414G probably damaging Het
Slco1a6 A G 6: 142,157,277 (GRCm38) S54P probably benign Het
Sos1 C A 17: 80,424,200 (GRCm38) V624F probably damaging Het
Spdef T C 17: 27,717,288 (GRCm38) D227G probably benign Het
Sptb G T 12: 76,624,229 (GRCm38) Q447K probably damaging Het
Srsf12 A T 4: 33,209,265 (GRCm38) R62W unknown Het
Stag3 T C 5: 138,291,366 (GRCm38) L266P probably damaging Het
Sult2b1 T C 7: 45,742,438 (GRCm38) probably benign Het
Taf1a A G 1: 183,409,276 (GRCm38) T66A Het
Tfg A T 16: 56,712,609 (GRCm38) probably null Het
Trim34b A G 7: 104,336,397 (GRCm38) N413S probably benign Het
Txndc15 T A 13: 55,721,586 (GRCm38) M184K probably damaging Het
Umodl1 A C 17: 30,982,332 (GRCm38) S412R probably damaging Het
Zbtb8b T A 4: 129,432,890 (GRCm38) M161L probably benign Het
Zfp597 A T 16: 3,866,505 (GRCm38) V129E probably benign Het
Zfp790 T C 7: 29,828,625 (GRCm38) I245T possibly damaging Het
Other mutations in Dnah7a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00479:Dnah7a APN 1 53,419,684 (GRCm38) missense probably damaging 0.99
IGL00510:Dnah7a APN 1 53,501,542 (GRCm38) missense probably damaging 1.00
IGL00545:Dnah7a APN 1 53,457,746 (GRCm38) missense possibly damaging 0.87
IGL01320:Dnah7a APN 1 53,434,046 (GRCm38) missense probably benign 0.32
IGL01322:Dnah7a APN 1 53,434,046 (GRCm38) missense probably benign 0.32
IGL01357:Dnah7a APN 1 53,662,381 (GRCm38) missense probably benign
IGL01417:Dnah7a APN 1 53,584,600 (GRCm38) missense probably benign 0.01
IGL01508:Dnah7a APN 1 53,627,072 (GRCm38) missense probably benign 0.00
IGL01511:Dnah7a APN 1 53,419,595 (GRCm38) missense probably damaging 1.00
IGL01545:Dnah7a APN 1 53,518,782 (GRCm38) missense probably benign
IGL01575:Dnah7a APN 1 53,427,820 (GRCm38) splice site probably benign
IGL01667:Dnah7a APN 1 53,547,292 (GRCm38) missense probably damaging 1.00
IGL01712:Dnah7a APN 1 53,423,270 (GRCm38) missense probably benign 0.23
IGL01824:Dnah7a APN 1 53,504,270 (GRCm38) missense probably benign
IGL01829:Dnah7a APN 1 53,618,068 (GRCm38) missense possibly damaging 0.64
IGL01861:Dnah7a APN 1 53,584,449 (GRCm38) splice site probably benign
IGL01861:Dnah7a APN 1 53,640,349 (GRCm38) missense probably benign 0.01
IGL01984:Dnah7a APN 1 53,702,015 (GRCm38) splice site probably null
IGL02056:Dnah7a APN 1 53,504,342 (GRCm38) missense probably benign 0.17
IGL02069:Dnah7a APN 1 53,561,894 (GRCm38) splice site probably benign
IGL02072:Dnah7a APN 1 53,605,827 (GRCm38) missense probably damaging 1.00
IGL02110:Dnah7a APN 1 53,411,580 (GRCm38) missense possibly damaging 0.52
IGL02120:Dnah7a APN 1 53,495,717 (GRCm38) missense possibly damaging 0.46
IGL02128:Dnah7a APN 1 53,437,513 (GRCm38) missense probably damaging 1.00
IGL02135:Dnah7a APN 1 53,623,473 (GRCm38) missense probably benign 0.01
IGL02151:Dnah7a APN 1 53,472,864 (GRCm38) missense probably benign 0.08
IGL02156:Dnah7a APN 1 53,419,723 (GRCm38) missense probably benign 0.27
IGL02270:Dnah7a APN 1 53,472,893 (GRCm38) missense possibly damaging 0.93
IGL02282:Dnah7a APN 1 53,643,510 (GRCm38) missense possibly damaging 0.93
IGL02328:Dnah7a APN 1 53,524,937 (GRCm38) critical splice donor site probably null
IGL02370:Dnah7a APN 1 53,635,397 (GRCm38) missense probably benign 0.00
IGL02420:Dnah7a APN 1 53,686,543 (GRCm38) missense probably benign
IGL02458:Dnah7a APN 1 53,618,328 (GRCm38) nonsense probably null
IGL02489:Dnah7a APN 1 53,647,322 (GRCm38) missense possibly damaging 0.94
IGL02554:Dnah7a APN 1 53,618,046 (GRCm38) missense possibly damaging 0.93
IGL02578:Dnah7a APN 1 53,432,915 (GRCm38) missense probably benign 0.00
IGL02646:Dnah7a APN 1 53,525,035 (GRCm38) missense probably damaging 0.99
IGL02675:Dnah7a APN 1 53,504,024 (GRCm38) missense possibly damaging 0.96
IGL02688:Dnah7a APN 1 53,444,472 (GRCm38) missense possibly damaging 0.93
IGL02858:Dnah7a APN 1 53,472,959 (GRCm38) splice site probably benign
IGL02874:Dnah7a APN 1 53,605,814 (GRCm38) missense possibly damaging 0.70
IGL02887:Dnah7a APN 1 53,522,360 (GRCm38) missense possibly damaging 0.46
IGL02894:Dnah7a APN 1 53,577,328 (GRCm38) missense probably benign 0.27
IGL02926:Dnah7a APN 1 53,495,950 (GRCm38) missense possibly damaging 0.64
IGL03113:Dnah7a APN 1 53,433,004 (GRCm38) missense possibly damaging 0.64
IGL03156:Dnah7a APN 1 53,605,824 (GRCm38) missense probably damaging 0.97
IGL03195:Dnah7a APN 1 53,419,607 (GRCm38) missense probably damaging 1.00
IGL03209:Dnah7a APN 1 53,686,614 (GRCm38) splice site probably benign
IGL03214:Dnah7a APN 1 53,522,209 (GRCm38) critical splice donor site probably null
IGL03242:Dnah7a APN 1 53,620,723 (GRCm38) missense probably benign 0.02
IGL03251:Dnah7a APN 1 53,647,274 (GRCm38) missense probably benign
IGL03265:Dnah7a APN 1 53,528,848 (GRCm38) missense probably benign
IGL03277:Dnah7a APN 1 53,630,322 (GRCm38) missense probably benign 0.00
IGL03278:Dnah7a APN 1 53,496,965 (GRCm38) missense probably benign 0.07
IGL03356:Dnah7a APN 1 53,503,934 (GRCm38) missense probably benign 0.01
PIT4378001:Dnah7a UTSW 1 53,531,203 (GRCm38) missense probably damaging 0.99
R0046:Dnah7a UTSW 1 53,456,874 (GRCm38) splice site probably null
R0051:Dnah7a UTSW 1 53,521,086 (GRCm38) splice site probably benign
R0082:Dnah7a UTSW 1 53,518,708 (GRCm38) missense probably damaging 1.00
R0111:Dnah7a UTSW 1 53,468,684 (GRCm38) missense probably benign 0.03
R0122:Dnah7a UTSW 1 53,397,142 (GRCm38) missense probably damaging 1.00
R0245:Dnah7a UTSW 1 53,501,526 (GRCm38) missense probably damaging 1.00
R0278:Dnah7a UTSW 1 53,504,146 (GRCm38) missense probably benign 0.00
R0309:Dnah7a UTSW 1 53,405,690 (GRCm38) missense probably damaging 0.97
R0334:Dnah7a UTSW 1 53,433,054 (GRCm38) missense possibly damaging 0.61
R0392:Dnah7a UTSW 1 53,504,198 (GRCm38) missense probably damaging 0.97
R0452:Dnah7a UTSW 1 53,605,819 (GRCm38) missense probably benign 0.00
R0511:Dnah7a UTSW 1 53,497,126 (GRCm38) missense probably benign
R0576:Dnah7a UTSW 1 53,636,087 (GRCm38) missense probably benign 0.12
R0592:Dnah7a UTSW 1 53,456,612 (GRCm38) missense possibly damaging 0.91
R0628:Dnah7a UTSW 1 53,497,105 (GRCm38) missense probably benign 0.18
R0689:Dnah7a UTSW 1 53,620,681 (GRCm38) nonsense probably null
R0735:Dnah7a UTSW 1 53,544,511 (GRCm38) missense possibly damaging 0.70
R0800:Dnah7a UTSW 1 53,565,696 (GRCm38) missense probably damaging 1.00
R0829:Dnah7a UTSW 1 53,504,079 (GRCm38) missense probably benign 0.07
R0842:Dnah7a UTSW 1 53,501,674 (GRCm38) missense possibly damaging 0.88
R0879:Dnah7a UTSW 1 53,427,860 (GRCm38) missense possibly damaging 0.85
R1331:Dnah7a UTSW 1 53,468,669 (GRCm38) missense probably damaging 0.99
R1418:Dnah7a UTSW 1 53,647,236 (GRCm38) splice site probably benign
R1421:Dnah7a UTSW 1 53,540,873 (GRCm38) splice site probably benign
R1445:Dnah7a UTSW 1 53,528,797 (GRCm38) missense probably benign 0.02
R1473:Dnah7a UTSW 1 53,496,014 (GRCm38) missense probably benign 0.00
R1538:Dnah7a UTSW 1 53,495,989 (GRCm38) missense possibly damaging 0.71
R1742:Dnah7a UTSW 1 53,456,684 (GRCm38) missense probably benign 0.39
R1754:Dnah7a UTSW 1 53,561,900 (GRCm38) critical splice donor site probably null
R1754:Dnah7a UTSW 1 53,504,185 (GRCm38) missense probably benign 0.18
R1773:Dnah7a UTSW 1 53,432,887 (GRCm38) splice site probably null
R1779:Dnah7a UTSW 1 53,577,223 (GRCm38) missense probably benign
R1816:Dnah7a UTSW 1 53,631,742 (GRCm38) splice site probably benign
R1817:Dnah7a UTSW 1 53,559,148 (GRCm38) missense probably benign
R1818:Dnah7a UTSW 1 53,559,148 (GRCm38) missense probably benign
R1819:Dnah7a UTSW 1 53,559,148 (GRCm38) missense probably benign
R1873:Dnah7a UTSW 1 53,456,532 (GRCm38) splice site probably benign
R1875:Dnah7a UTSW 1 53,456,532 (GRCm38) splice site probably benign
R1884:Dnah7a UTSW 1 53,541,000 (GRCm38) missense probably damaging 0.99
R1902:Dnah7a UTSW 1 53,535,478 (GRCm38) missense probably damaging 1.00
R1903:Dnah7a UTSW 1 53,535,478 (GRCm38) missense probably damaging 1.00
R1908:Dnah7a UTSW 1 53,631,562 (GRCm38) missense probably benign
R1959:Dnah7a UTSW 1 53,684,983 (GRCm38) missense probably benign 0.00
R1960:Dnah7a UTSW 1 53,684,983 (GRCm38) missense probably benign 0.00
R1985:Dnah7a UTSW 1 53,503,934 (GRCm38) missense probably benign 0.01
R1992:Dnah7a UTSW 1 53,582,676 (GRCm38) missense possibly damaging 0.91
R2037:Dnah7a UTSW 1 53,582,582 (GRCm38) missense probably benign 0.00
R2074:Dnah7a UTSW 1 53,457,696 (GRCm38) missense probably benign 0.45
R2076:Dnah7a UTSW 1 53,503,809 (GRCm38) missense probably benign 0.01
R2124:Dnah7a UTSW 1 53,496,942 (GRCm38) missense possibly damaging 0.58
R2191:Dnah7a UTSW 1 53,605,875 (GRCm38) missense possibly damaging 0.54
R2211:Dnah7a UTSW 1 53,479,773 (GRCm38) missense probably benign 0.21
R2220:Dnah7a UTSW 1 53,521,174 (GRCm38) missense probably benign
R2355:Dnah7a UTSW 1 53,582,502 (GRCm38) missense probably benign 0.00
R2495:Dnah7a UTSW 1 53,605,881 (GRCm38) missense probably damaging 1.00
R2901:Dnah7a UTSW 1 53,427,872 (GRCm38) missense probably damaging 0.99
R2911:Dnah7a UTSW 1 53,427,824 (GRCm38) critical splice donor site probably null
R2993:Dnah7a UTSW 1 53,503,554 (GRCm38) missense probably damaging 1.00
R3522:Dnah7a UTSW 1 53,618,116 (GRCm38) missense probably damaging 1.00
R3683:Dnah7a UTSW 1 53,444,516 (GRCm38) missense probably benign
R3723:Dnah7a UTSW 1 53,447,346 (GRCm38) missense probably benign 0.04
R3847:Dnah7a UTSW 1 53,501,656 (GRCm38) missense probably benign 0.01
R4002:Dnah7a UTSW 1 53,631,681 (GRCm38) missense probably benign
R4009:Dnah7a UTSW 1 53,525,005 (GRCm38) missense probably damaging 1.00
R4063:Dnah7a UTSW 1 53,425,217 (GRCm38) missense probably benign
R4193:Dnah7a UTSW 1 53,447,334 (GRCm38) missense probably benign 0.00
R4236:Dnah7a UTSW 1 53,447,365 (GRCm38) missense probably benign 0.00
R4399:Dnah7a UTSW 1 53,518,727 (GRCm38) missense probably damaging 1.00
R4469:Dnah7a UTSW 1 53,444,526 (GRCm38) missense probably benign 0.01
R4494:Dnah7a UTSW 1 53,449,038 (GRCm38) missense probably benign 0.01
R4569:Dnah7a UTSW 1 53,411,659 (GRCm38) missense probably benign 0.01
R4609:Dnah7a UTSW 1 53,456,657 (GRCm38) missense possibly damaging 0.80
R4632:Dnah7a UTSW 1 53,427,951 (GRCm38) missense probably damaging 0.97
R4703:Dnah7a UTSW 1 53,447,317 (GRCm38) critical splice donor site probably null
R4781:Dnah7a UTSW 1 53,425,208 (GRCm38) missense probably benign 0.28
R4854:Dnah7a UTSW 1 53,706,729 (GRCm38) utr 5 prime probably benign
R4932:Dnah7a UTSW 1 53,503,578 (GRCm38) missense possibly damaging 0.90
R4976:Dnah7a UTSW 1 53,698,692 (GRCm38) missense probably benign
R5000:Dnah7a UTSW 1 53,567,042 (GRCm38) missense probably damaging 1.00
R5023:Dnah7a UTSW 1 53,647,248 (GRCm38) nonsense probably null
R5026:Dnah7a UTSW 1 53,662,498 (GRCm38) missense probably damaging 0.99
R5050:Dnah7a UTSW 1 53,497,096 (GRCm38) missense probably benign 0.01
R5119:Dnah7a UTSW 1 53,698,692 (GRCm38) missense probably benign
R5151:Dnah7a UTSW 1 53,620,770 (GRCm38) missense probably benign 0.00
R5155:Dnah7a UTSW 1 53,643,495 (GRCm38) missense probably benign 0.01
R5180:Dnah7a UTSW 1 53,423,287 (GRCm38) missense probably damaging 0.97
R5228:Dnah7a UTSW 1 53,437,609 (GRCm38) critical splice acceptor site probably null
R5237:Dnah7a UTSW 1 53,447,531 (GRCm38) splice site probably null
R5267:Dnah7a UTSW 1 53,479,692 (GRCm38) missense probably damaging 1.00
R5334:Dnah7a UTSW 1 53,503,646 (GRCm38) missense probably benign 0.00
R5358:Dnah7a UTSW 1 53,547,172 (GRCm38) missense probably damaging 1.00
R5401:Dnah7a UTSW 1 53,631,653 (GRCm38) missense probably benign 0.01
R5412:Dnah7a UTSW 1 53,635,344 (GRCm38) missense probably benign
R5496:Dnah7a UTSW 1 53,457,768 (GRCm38) missense probably benign
R5531:Dnah7a UTSW 1 53,419,748 (GRCm38) missense possibly damaging 0.50
R5536:Dnah7a UTSW 1 53,425,253 (GRCm38) missense probably benign
R5543:Dnah7a UTSW 1 53,504,069 (GRCm38) missense probably damaging 1.00
R5597:Dnah7a UTSW 1 53,534,452 (GRCm38) missense probably benign 0.00
R5609:Dnah7a UTSW 1 53,582,594 (GRCm38) missense probably benign 0.03
R5643:Dnah7a UTSW 1 53,405,707 (GRCm38) missense probably benign
R5644:Dnah7a UTSW 1 53,540,979 (GRCm38) missense probably benign 0.33
R5689:Dnah7a UTSW 1 53,405,698 (GRCm38) missense possibly damaging 0.87
R5715:Dnah7a UTSW 1 53,413,778 (GRCm38) missense probably damaging 1.00
R5780:Dnah7a UTSW 1 53,483,319 (GRCm38) missense probably benign 0.03
R5893:Dnah7a UTSW 1 53,457,785 (GRCm38) missense possibly damaging 0.66
R5946:Dnah7a UTSW 1 53,559,308 (GRCm38) missense probably damaging 1.00
R5995:Dnah7a UTSW 1 53,620,670 (GRCm38) missense probably benign 0.00
R6102:Dnah7a UTSW 1 53,559,140 (GRCm38) missense probably benign 0.00
R6108:Dnah7a UTSW 1 53,456,845 (GRCm38) missense probably damaging 1.00
R6133:Dnah7a UTSW 1 53,419,655 (GRCm38) missense probably benign 0.05
R6168:Dnah7a UTSW 1 53,411,568 (GRCm38) missense probably damaging 1.00
R6175:Dnah7a UTSW 1 53,433,022 (GRCm38) missense probably damaging 1.00
R6211:Dnah7a UTSW 1 53,419,636 (GRCm38) missense probably damaging 0.99
R6282:Dnah7a UTSW 1 53,503,601 (GRCm38) missense probably damaging 1.00
R6329:Dnah7a UTSW 1 53,541,114 (GRCm38) missense probably damaging 1.00
R6344:Dnah7a UTSW 1 53,397,190 (GRCm38) missense probably benign 0.02
R6530:Dnah7a UTSW 1 53,503,697 (GRCm38) missense probably benign 0.04
R6574:Dnah7a UTSW 1 53,456,534 (GRCm38) critical splice donor site probably null
R6608:Dnah7a UTSW 1 53,525,118 (GRCm38) missense probably benign
R6625:Dnah7a UTSW 1 53,565,757 (GRCm38) missense probably benign 0.05
R6661:Dnah7a UTSW 1 53,623,450 (GRCm38) missense probably benign 0.00
R6681:Dnah7a UTSW 1 53,521,226 (GRCm38) critical splice acceptor site probably null
R6747:Dnah7a UTSW 1 53,636,062 (GRCm38) missense probably benign 0.01
R6774:Dnah7a UTSW 1 53,698,651 (GRCm38) missense probably benign
R6823:Dnah7a UTSW 1 53,456,704 (GRCm38) missense probably benign
R6900:Dnah7a UTSW 1 53,662,351 (GRCm38) missense probably damaging 0.97
R6940:Dnah7a UTSW 1 53,631,677 (GRCm38) missense probably benign 0.09
R6956:Dnah7a UTSW 1 53,577,287 (GRCm38) missense probably benign 0.02
R6978:Dnah7a UTSW 1 53,662,367 (GRCm38) missense probably null
R6988:Dnah7a UTSW 1 53,582,625 (GRCm38) missense possibly damaging 0.62
R7026:Dnah7a UTSW 1 53,504,289 (GRCm38) missense probably benign
R7027:Dnah7a UTSW 1 53,631,506 (GRCm38) missense probably benign 0.01
R7033:Dnah7a UTSW 1 53,479,661 (GRCm38) missense probably damaging 1.00
R7072:Dnah7a UTSW 1 53,419,753 (GRCm38) missense probably benign 0.00
R7096:Dnah7a UTSW 1 53,483,440 (GRCm38) missense possibly damaging 0.90
R7142:Dnah7a UTSW 1 53,413,768 (GRCm38) nonsense probably null
R7144:Dnah7a UTSW 1 53,698,708 (GRCm38) splice site probably null
R7167:Dnah7a UTSW 1 53,503,776 (GRCm38) missense probably benign 0.00
R7182:Dnah7a UTSW 1 53,620,461 (GRCm38) splice site probably null
R7196:Dnah7a UTSW 1 53,684,841 (GRCm38) missense probably benign 0.00
R7206:Dnah7a UTSW 1 53,698,633 (GRCm38) nonsense probably null
R7215:Dnah7a UTSW 1 53,618,350 (GRCm38) missense probably damaging 0.99
R7224:Dnah7a UTSW 1 53,397,261 (GRCm38) missense probably benign 0.00
R7264:Dnah7a UTSW 1 53,518,814 (GRCm38) missense probably benign
R7282:Dnah7a UTSW 1 53,684,900 (GRCm38) critical splice acceptor site probably null
R7365:Dnah7a UTSW 1 53,497,138 (GRCm38) missense probably benign
R7454:Dnah7a UTSW 1 53,518,764 (GRCm38) missense probably benign
R7471:Dnah7a UTSW 1 53,419,699 (GRCm38) missense probably damaging 1.00
R7547:Dnah7a UTSW 1 53,663,837 (GRCm38) missense probably benign 0.00
R7554:Dnah7a UTSW 1 53,528,698 (GRCm38) missense possibly damaging 0.87
R7655:Dnah7a UTSW 1 53,496,005 (GRCm38) missense possibly damaging 0.50
R7656:Dnah7a UTSW 1 53,496,005 (GRCm38) missense possibly damaging 0.50
R7666:Dnah7a UTSW 1 53,547,297 (GRCm38) missense probably benign 0.00
R7721:Dnah7a UTSW 1 53,631,683 (GRCm38) missense probably benign
R7813:Dnah7a UTSW 1 53,618,086 (GRCm38) missense probably benign
R7839:Dnah7a UTSW 1 53,567,175 (GRCm38) missense probably benign 0.08
R7959:Dnah7a UTSW 1 53,643,462 (GRCm38) missense probably benign 0.00
R7984:Dnah7a UTSW 1 53,504,218 (GRCm38) missense probably benign 0.01
R7985:Dnah7a UTSW 1 53,518,727 (GRCm38) missense probably damaging 1.00
R8116:Dnah7a UTSW 1 53,503,890 (GRCm38) missense probably benign
R8140:Dnah7a UTSW 1 53,501,589 (GRCm38) missense probably benign 0.02
R8184:Dnah7a UTSW 1 53,627,035 (GRCm38) missense probably benign 0.03
R8339:Dnah7a UTSW 1 53,685,019 (GRCm38) missense probably benign
R8352:Dnah7a UTSW 1 53,427,827 (GRCm38) missense probably null 0.01
R8423:Dnah7a UTSW 1 53,472,904 (GRCm38) missense possibly damaging 0.84
R8428:Dnah7a UTSW 1 53,472,953 (GRCm38) missense probably damaging 0.98
R8432:Dnah7a UTSW 1 53,618,036 (GRCm38) missense possibly damaging 0.46
R8452:Dnah7a UTSW 1 53,427,827 (GRCm38) missense probably null 0.01
R8458:Dnah7a UTSW 1 53,617,983 (GRCm38) missense probably benign 0.01
R8493:Dnah7a UTSW 1 53,472,908 (GRCm38) missense probably damaging 1.00
R8498:Dnah7a UTSW 1 53,617,980 (GRCm38) missense probably benign 0.01
R8502:Dnah7a UTSW 1 53,640,361 (GRCm38) missense probably benign 0.39
R8692:Dnah7a UTSW 1 53,433,016 (GRCm38) missense probably benign 0.00
R8700:Dnah7a UTSW 1 53,495,929 (GRCm38) missense possibly damaging 0.62
R8709:Dnah7a UTSW 1 53,635,317 (GRCm38) missense probably benign
R8856:Dnah7a UTSW 1 53,423,263 (GRCm38) missense probably damaging 1.00
R8875:Dnah7a UTSW 1 53,643,523 (GRCm38) missense probably benign 0.10
R8967:Dnah7a UTSW 1 53,643,435 (GRCm38) splice site probably benign
R8982:Dnah7a UTSW 1 53,531,142 (GRCm38) missense probably benign
R8984:Dnah7a UTSW 1 53,635,277 (GRCm38) nonsense probably null
R8993:Dnah7a UTSW 1 53,504,103 (GRCm38) missense probably damaging 1.00
R9008:Dnah7a UTSW 1 53,662,342 (GRCm38) missense possibly damaging 0.81
R9022:Dnah7a UTSW 1 53,472,957 (GRCm38) critical splice acceptor site probably null
R9028:Dnah7a UTSW 1 53,521,138 (GRCm38) missense probably benign 0.00
R9077:Dnah7a UTSW 1 53,702,059 (GRCm38) missense unknown
R9167:Dnah7a UTSW 1 53,618,211 (GRCm38) missense probably benign 0.00
R9206:Dnah7a UTSW 1 53,501,598 (GRCm38) missense probably benign 0.11
R9226:Dnah7a UTSW 1 53,521,167 (GRCm38) missense possibly damaging 0.93
R9251:Dnah7a UTSW 1 53,582,512 (GRCm38) missense probably damaging 1.00
R9265:Dnah7a UTSW 1 53,635,346 (GRCm38) missense probably benign
R9350:Dnah7a UTSW 1 53,397,148 (GRCm38) missense probably benign 0.19
R9369:Dnah7a UTSW 1 53,525,063 (GRCm38) missense possibly damaging 0.72
R9369:Dnah7a UTSW 1 53,504,262 (GRCm38) missense probably benign
R9372:Dnah7a UTSW 1 53,504,315 (GRCm38) missense probably benign
R9376:Dnah7a UTSW 1 53,528,899 (GRCm38) critical splice acceptor site probably null
R9378:Dnah7a UTSW 1 53,582,617 (GRCm38) missense probably benign 0.32
R9401:Dnah7a UTSW 1 53,528,867 (GRCm38) missense probably benign 0.01
R9431:Dnah7a UTSW 1 53,411,653 (GRCm38) missense possibly damaging 0.90
R9529:Dnah7a UTSW 1 53,522,336 (GRCm38) missense probably damaging 1.00
R9701:Dnah7a UTSW 1 53,522,229 (GRCm38) missense probably benign 0.03
R9712:Dnah7a UTSW 1 53,559,140 (GRCm38) missense probably benign 0.00
R9799:Dnah7a UTSW 1 53,518,809 (GRCm38) missense probably benign 0.00
R9802:Dnah7a UTSW 1 53,522,229 (GRCm38) missense probably benign 0.03
X0027:Dnah7a UTSW 1 53,472,930 (GRCm38) missense probably damaging 1.00
Z1088:Dnah7a UTSW 1 53,468,643 (GRCm38) missense probably damaging 1.00
Z1176:Dnah7a UTSW 1 53,483,463 (GRCm38) missense probably damaging 1.00
Z1176:Dnah7a UTSW 1 53,419,699 (GRCm38) missense probably damaging 1.00
Z1177:Dnah7a UTSW 1 53,559,102 (GRCm38) missense probably benign 0.21
Z1177:Dnah7a UTSW 1 53,411,656 (GRCm38) missense probably benign 0.08
Z1177:Dnah7a UTSW 1 53,643,457 (GRCm38) missense possibly damaging 0.92
Predicted Primers PCR Primer
(F):5'- GACTCTGTAAGCACTGACTCC -3'
(R):5'- GAGCATGTCTTTCCCACTGTATG -3'

Sequencing Primer
(F):5'- CACATTTGTTTGCACCATTGTTATG -3'
(R):5'- CCCACTGTATGTTCCAAACTATTC -3'
Posted On 2019-09-13