Incidental Mutation 'R7392:Fam129a'
ID573481
Institutional Source Beutler Lab
Gene Symbol Fam129a
Ensembl Gene ENSMUSG00000026483
Gene Namefamily with sequence similarity 129, member A
SynonymsNiban
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7392 (G1)
Quality Score225.009
Status Not validated
Chromosome1
Chromosomal Location151571186-151721939 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 151696224 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 307 (T307A)
Ref Sequence ENSEMBL: ENSMUSP00000115822 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000097541] [ENSMUST00000148810]
Predicted Effect probably damaging
Transcript: ENSMUST00000097541
AA Change: T307A

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000095148
Gene: ENSMUSG00000026483
AA Change: T307A

DomainStartEndE-ValueType
Blast:PH 70 197 2e-83 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000148810
AA Change: T307A

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000115822
Gene: ENSMUSG00000026483
AA Change: T307A

DomainStartEndE-ValueType
SCOP:d1faoa_ 67 118 1e-2 SMART
Blast:PH 70 197 1e-80 BLAST
low complexity region 540 549 N/A INTRINSIC
low complexity region 699 714 N/A INTRINSIC
low complexity region 784 797 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the family with sequence similarity 129 protein family. This gene is highly expressed in several cancer cells and may serve as a prognostic marker for certain cancers. The encoded protein may play a role in regulating p53-mediated apoptosis. [provided by RefSeq, Sep 2016]
PHENOTYPE: Mice homozygous for a knock-out allele are viable with no overt phenotypic abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 83 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610021A01Rik T A 7: 41,626,566 F564L probably damaging Het
4930539E08Rik A T 17: 28,908,377 D219E probably benign Het
9530053A07Rik C T 7: 28,164,372 T2523M possibly damaging Het
Abcc2 T C 19: 43,808,687 I499T probably damaging Het
Adamts13 C T 2: 26,989,324 R630C probably damaging Het
Adgrv1 A T 13: 81,560,689 F1199I probably damaging Het
Agbl5 G A 5: 30,890,771 probably null Het
Anks1b A G 10: 90,680,786 D881G possibly damaging Het
Arap2 A T 5: 62,698,385 S569R possibly damaging Het
Arhgap15 T C 2: 44,063,774 S171P possibly damaging Het
Arhgef11 G A 3: 87,717,175 probably null Het
Baz1a C A 12: 54,898,765 L1271F probably damaging Het
Bdnf A C 2: 109,723,930 K216N probably benign Het
Bmp7 C T 2: 172,870,205 D409N probably damaging Het
Cacna1c T A 6: 118,741,920 I390F Het
Chd8 A G 14: 52,232,855 S433P probably benign Het
Clrn2 A G 5: 45,463,909 E215G possibly damaging Het
Col19a1 T G 1: 24,534,034 D219A unknown Het
Col2a1 G A 15: 97,980,151 R1036* probably null Het
Copg1 T A 6: 87,890,275 V110D probably benign Het
Cpd C T 11: 76,801,779 G744D probably damaging Het
Crygs G A 16: 22,806,502 P63L probably benign Het
Dcn A G 10: 97,509,998 D224G probably damaging Het
Dnah7a T C 1: 53,501,661 E2518G probably benign Het
Efcab6 C A 15: 83,988,951 R197L probably benign Het
Efr3b T A 12: 3,969,588 Y723F probably benign Het
Enam A G 5: 88,501,664 N344S probably damaging Het
Erich4 A G 7: 25,615,676 I58T possibly damaging Het
Esrp1 A G 4: 11,338,809 V665A probably benign Het
Etf1 G A 18: 34,906,050 T388I probably benign Het
Faf1 A G 4: 109,794,843 T244A probably benign Het
Fbn1 T C 2: 125,343,924 D1610G probably damaging Het
Frem1 G T 4: 83,013,827 F212L probably benign Het
Fuom T A 7: 140,101,160 D85V probably damaging Het
Gcfc2 T C 6: 81,943,012 probably null Het
Gpr37 C T 6: 25,688,787 A104T probably benign Het
Hsp90ab1 G C 17: 45,569,048 T514S probably benign Het
Ifnl2 A G 7: 28,509,669 F74L probably benign Het
Ipo11 G A 13: 106,891,691 R367* probably null Het
Itpr2 T C 6: 146,359,340 D963G possibly damaging Het
Krt15 A T 11: 100,135,560 V100E possibly damaging Het
Lrch3 T A 16: 32,986,755 L466* probably null Het
Lrfn5 A T 12: 61,840,304 T293S probably benign Het
Lrp5 A G 19: 3,610,199 I955T probably damaging Het
Lrrc4b C T 7: 44,462,015 T437M probably damaging Het
Man1a A G 10: 53,919,187 Y657H probably damaging Het
Mapkap1 G T 2: 34,435,154 R94L probably damaging Het
Mtmr4 T A 11: 87,604,557 L480Q probably damaging Het
Mycbp2 T C 14: 103,152,191 I3504M probably damaging Het
Mycbp2 A T 14: 103,243,128 C1169S probably damaging Het
Myo15 T C 11: 60,505,976 S1455P Het
Nid2 A G 14: 19,768,656 D406G probably benign Het
Nrip2 A G 6: 128,404,950 I69V probably benign Het
Nthl1 G A 17: 24,638,624 V266I probably benign Het
Olfr1000 A C 2: 85,608,488 C141G possibly damaging Het
Olfr1061 A G 2: 86,413,152 V300A probably benign Het
Olfr1440 G T 19: 12,394,465 L67F probably damaging Het
Olfr1444 A G 19: 12,862,587 T271A probably benign Het
Olfr284 A G 15: 98,340,311 V226A probably benign Het
Olfr501-ps1 C A 7: 108,508,084 H9Q possibly damaging Het
Olfr698 T C 7: 106,753,382 E2G possibly damaging Het
Pcdhb1 A C 18: 37,265,118 S41R possibly damaging Het
Pdcd11 T A 19: 47,127,997 F1529I probably damaging Het
Plcd3 C A 11: 103,101,557 probably benign Het
Qdpr T C 5: 45,439,376 M149V probably benign Het
R3hcc1 T A 14: 69,705,880 probably null Het
Rasgrf2 T C 13: 91,893,737 Y392C Het
Slc8a3 A C 12: 81,314,803 V414G probably damaging Het
Slco1a6 A G 6: 142,157,277 S54P probably benign Het
Sos1 C A 17: 80,424,200 V624F probably damaging Het
Spdef T C 17: 27,717,288 D227G probably benign Het
Sptb G T 12: 76,624,229 Q447K probably damaging Het
Srsf12 A T 4: 33,209,265 R62W unknown Het
Stag3 T C 5: 138,291,366 L266P probably damaging Het
Sult2b1 T C 7: 45,742,438 probably benign Het
Taf1a A G 1: 183,409,276 T66A Het
Tfg A T 16: 56,712,609 probably null Het
Trim34b A G 7: 104,336,397 N413S probably benign Het
Txndc15 T A 13: 55,721,586 M184K probably damaging Het
Umodl1 A C 17: 30,982,332 S412R probably damaging Het
Zbtb8b T A 4: 129,432,890 M161L probably benign Het
Zfp597 A T 16: 3,866,505 V129E probably benign Het
Zfp790 T C 7: 29,828,625 I245T possibly damaging Het
Other mutations in Fam129a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01150:Fam129a APN 1 151717721 missense probably benign 0.06
IGL01690:Fam129a APN 1 151703804 missense probably damaging 1.00
IGL01762:Fam129a APN 1 151636491 missense probably damaging 1.00
IGL01784:Fam129a APN 1 151649365 missense probably damaging 1.00
IGL01938:Fam129a APN 1 151689614 missense probably benign 0.22
IGL02427:Fam129a APN 1 151717274 missense probably damaging 1.00
IGL02617:Fam129a APN 1 151571545 missense probably benign 0.11
IGL02946:Fam129a APN 1 151649425 missense probably damaging 0.99
R0242:Fam129a UTSW 1 151718216 missense probably benign 0.00
R0242:Fam129a UTSW 1 151718216 missense probably benign 0.00
R0279:Fam129a UTSW 1 151709206 critical splice donor site probably null
R0421:Fam129a UTSW 1 151709082 splice site probably benign
R0531:Fam129a UTSW 1 151718084 missense probably benign 0.11
R0725:Fam129a UTSW 1 151706015 missense probably benign 0.04
R1493:Fam129a UTSW 1 151706090 missense probably damaging 1.00
R1563:Fam129a UTSW 1 151715673 missense possibly damaging 0.69
R1868:Fam129a UTSW 1 151641551 missense possibly damaging 0.71
R1944:Fam129a UTSW 1 151696228 missense probably damaging 0.99
R1945:Fam129a UTSW 1 151696228 missense probably damaging 0.99
R2071:Fam129a UTSW 1 151636430 missense probably damaging 1.00
R2126:Fam129a UTSW 1 151696135 missense probably damaging 1.00
R2126:Fam129a UTSW 1 151709133 missense possibly damaging 0.94
R2138:Fam129a UTSW 1 151696251 missense probably damaging 0.98
R2180:Fam129a UTSW 1 151718078 missense probably benign 0.02
R2402:Fam129a UTSW 1 151689614 missense probably benign 0.22
R3689:Fam129a UTSW 1 151703696 splice site probably null
R3783:Fam129a UTSW 1 151689648 missense possibly damaging 0.66
R3975:Fam129a UTSW 1 151649335 missense probably damaging 1.00
R4029:Fam129a UTSW 1 151695690 missense probably benign 0.00
R4328:Fam129a UTSW 1 151636418 missense possibly damaging 0.86
R4447:Fam129a UTSW 1 151636402 critical splice acceptor site probably null
R4573:Fam129a UTSW 1 151703766 missense possibly damaging 0.85
R4774:Fam129a UTSW 1 151715694 missense probably damaging 1.00
R5064:Fam129a UTSW 1 151689659 missense probably benign 0.05
R5077:Fam129a UTSW 1 151714523 missense probably benign 0.00
R5187:Fam129a UTSW 1 151703829 missense possibly damaging 0.50
R5484:Fam129a UTSW 1 151718086 missense probably benign 0.08
R5553:Fam129a UTSW 1 151717235 missense probably damaging 0.99
R5572:Fam129a UTSW 1 151709190 missense probably benign 0.05
R5575:Fam129a UTSW 1 151718240 missense probably benign 0.31
R5586:Fam129a UTSW 1 151717556 missense probably benign 0.00
R5697:Fam129a UTSW 1 151700261 missense probably damaging 1.00
R6305:Fam129a UTSW 1 151695718 missense probably damaging 1.00
R7065:Fam129a UTSW 1 151700107 critical splice acceptor site probably null
R7126:Fam129a UTSW 1 151714567 nonsense probably null
R7571:Fam129a UTSW 1 151718297 missense probably benign 0.01
R7577:Fam129a UTSW 1 151718312 missense probably benign
R7939:Fam129a UTSW 1 151706024 missense probably damaging 1.00
R8018:Fam129a UTSW 1 151717255 nonsense probably null
R8164:Fam129a UTSW 1 151717588 missense probably benign 0.02
R8356:Fam129a UTSW 1 151696150 missense probably damaging 1.00
R8478:Fam129a UTSW 1 151636512 missense possibly damaging 0.77
Predicted Primers PCR Primer
(F):5'- ACCTGCTCAATCTCACTGGC -3'
(R):5'- CTCAGCTTAATTCTCTTCGGAAAC -3'

Sequencing Primer
(F):5'- CAGAGTCGTTCTTACAATTTGAGC -3'
(R):5'- GAGAAGCCTGAACCTGATCATTGC -3'
Posted On2019-09-13