Incidental Mutation 'R7392:Srsf12'
ID573493
Institutional Source Beutler Lab
Gene Symbol Srsf12
Ensembl Gene ENSMUSG00000054679
Gene Nameserine/arginine-rich splicing factor 12
SynonymsSfrs13b, Srrp
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.154) question?
Stock #R7392 (G1)
Quality Score225.009
Status Not validated
Chromosome4
Chromosomal Location33208991-33233340 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 33209265 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Tryptophan at position 62 (R62W)
Ref Sequence ENSEMBL: ENSMUSP00000067939 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000067864] [ENSMUST00000108159]
Predicted Effect unknown
Transcript: ENSMUST00000067864
AA Change: R62W
SMART Domains Protein: ENSMUSP00000067939
Gene: ENSMUSG00000054679
AA Change: R62W

DomainStartEndE-ValueType
low complexity region 31 75 N/A INTRINSIC
low complexity region 79 96 N/A INTRINSIC
low complexity region 110 141 N/A INTRINSIC
low complexity region 145 166 N/A INTRINSIC
low complexity region 172 196 N/A INTRINSIC
internal_repeat_1 204 216 9.52e-5 PROSPERO
internal_repeat_1 232 244 9.52e-5 PROSPERO
low complexity region 248 262 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000108159
SMART Domains Protein: ENSMUSP00000103794
Gene: ENSMUSG00000054679

DomainStartEndE-ValueType
RRM 11 84 9.99e-24 SMART
low complexity region 105 136 N/A INTRINSIC
low complexity region 140 161 N/A INTRINSIC
low complexity region 167 191 N/A INTRINSIC
low complexity region 243 257 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 83 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610021A01Rik T A 7: 41,626,566 F564L probably damaging Het
4930539E08Rik A T 17: 28,908,377 D219E probably benign Het
9530053A07Rik C T 7: 28,164,372 T2523M possibly damaging Het
Abcc2 T C 19: 43,808,687 I499T probably damaging Het
Adamts13 C T 2: 26,989,324 R630C probably damaging Het
Adgrv1 A T 13: 81,560,689 F1199I probably damaging Het
Agbl5 G A 5: 30,890,771 probably null Het
Anks1b A G 10: 90,680,786 D881G possibly damaging Het
Arap2 A T 5: 62,698,385 S569R possibly damaging Het
Arhgap15 T C 2: 44,063,774 S171P possibly damaging Het
Arhgef11 G A 3: 87,717,175 probably null Het
Baz1a C A 12: 54,898,765 L1271F probably damaging Het
Bdnf A C 2: 109,723,930 K216N probably benign Het
Bmp7 C T 2: 172,870,205 D409N probably damaging Het
Cacna1c T A 6: 118,741,920 I390F Het
Chd8 A G 14: 52,232,855 S433P probably benign Het
Clrn2 A G 5: 45,463,909 E215G possibly damaging Het
Col19a1 T G 1: 24,534,034 D219A unknown Het
Col2a1 G A 15: 97,980,151 R1036* probably null Het
Copg1 T A 6: 87,890,275 V110D probably benign Het
Cpd C T 11: 76,801,779 G744D probably damaging Het
Crygs G A 16: 22,806,502 P63L probably benign Het
Dcn A G 10: 97,509,998 D224G probably damaging Het
Dnah7a T C 1: 53,501,661 E2518G probably benign Het
Efcab6 C A 15: 83,988,951 R197L probably benign Het
Efr3b T A 12: 3,969,588 Y723F probably benign Het
Enam A G 5: 88,501,664 N344S probably damaging Het
Erich4 A G 7: 25,615,676 I58T possibly damaging Het
Esrp1 A G 4: 11,338,809 V665A probably benign Het
Etf1 G A 18: 34,906,050 T388I probably benign Het
Faf1 A G 4: 109,794,843 T244A probably benign Het
Fam129a A G 1: 151,696,224 T307A probably damaging Het
Fbn1 T C 2: 125,343,924 D1610G probably damaging Het
Frem1 G T 4: 83,013,827 F212L probably benign Het
Fuom T A 7: 140,101,160 D85V probably damaging Het
Gcfc2 T C 6: 81,943,012 probably null Het
Gpr37 C T 6: 25,688,787 A104T probably benign Het
Hsp90ab1 G C 17: 45,569,048 T514S probably benign Het
Ifnl2 A G 7: 28,509,669 F74L probably benign Het
Ipo11 G A 13: 106,891,691 R367* probably null Het
Itpr2 T C 6: 146,359,340 D963G possibly damaging Het
Krt15 A T 11: 100,135,560 V100E possibly damaging Het
Lrch3 T A 16: 32,986,755 L466* probably null Het
Lrfn5 A T 12: 61,840,304 T293S probably benign Het
Lrp5 A G 19: 3,610,199 I955T probably damaging Het
Lrrc4b C T 7: 44,462,015 T437M probably damaging Het
Man1a A G 10: 53,919,187 Y657H probably damaging Het
Mapkap1 G T 2: 34,435,154 R94L probably damaging Het
Mtmr4 T A 11: 87,604,557 L480Q probably damaging Het
Mycbp2 T C 14: 103,152,191 I3504M probably damaging Het
Mycbp2 A T 14: 103,243,128 C1169S probably damaging Het
Myo15 T C 11: 60,505,976 S1455P Het
Nid2 A G 14: 19,768,656 D406G probably benign Het
Nrip2 A G 6: 128,404,950 I69V probably benign Het
Nthl1 G A 17: 24,638,624 V266I probably benign Het
Olfr1000 A C 2: 85,608,488 C141G possibly damaging Het
Olfr1061 A G 2: 86,413,152 V300A probably benign Het
Olfr1440 G T 19: 12,394,465 L67F probably damaging Het
Olfr1444 A G 19: 12,862,587 T271A probably benign Het
Olfr284 A G 15: 98,340,311 V226A probably benign Het
Olfr501-ps1 C A 7: 108,508,084 H9Q possibly damaging Het
Olfr698 T C 7: 106,753,382 E2G possibly damaging Het
Pcdhb1 A C 18: 37,265,118 S41R possibly damaging Het
Pdcd11 T A 19: 47,127,997 F1529I probably damaging Het
Plcd3 C A 11: 103,101,557 probably benign Het
Qdpr T C 5: 45,439,376 M149V probably benign Het
R3hcc1 T A 14: 69,705,880 probably null Het
Rasgrf2 T C 13: 91,893,737 Y392C Het
Slc8a3 A C 12: 81,314,803 V414G probably damaging Het
Slco1a6 A G 6: 142,157,277 S54P probably benign Het
Sos1 C A 17: 80,424,200 V624F probably damaging Het
Spdef T C 17: 27,717,288 D227G probably benign Het
Sptb G T 12: 76,624,229 Q447K probably damaging Het
Stag3 T C 5: 138,291,366 L266P probably damaging Het
Sult2b1 T C 7: 45,742,438 probably benign Het
Taf1a A G 1: 183,409,276 T66A Het
Tfg A T 16: 56,712,609 probably null Het
Trim34b A G 7: 104,336,397 N413S probably benign Het
Txndc15 T A 13: 55,721,586 M184K probably damaging Het
Umodl1 A C 17: 30,982,332 S412R probably damaging Het
Zbtb8b T A 4: 129,432,890 M161L probably benign Het
Zfp597 A T 16: 3,866,505 V129E probably benign Het
Zfp790 T C 7: 29,828,625 I245T possibly damaging Het
Other mutations in Srsf12
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00952:Srsf12 APN 4 33226103 missense possibly damaging 0.66
IGL02245:Srsf12 APN 4 33209103 unclassified probably benign
IGL03197:Srsf12 APN 4 33231040 missense probably damaging 1.00
IGL03412:Srsf12 APN 4 33230929 missense probably damaging 0.99
R0173:Srsf12 UTSW 4 33226117 missense probably damaging 1.00
R0704:Srsf12 UTSW 4 33231069 missense probably damaging 0.99
R1618:Srsf12 UTSW 4 33230974 missense probably damaging 0.99
R2130:Srsf12 UTSW 4 33225764 critical splice acceptor site probably benign
R2916:Srsf12 UTSW 4 33231042 nonsense probably null
R2989:Srsf12 UTSW 4 33223599 missense probably damaging 1.00
R4350:Srsf12 UTSW 4 33223612 missense possibly damaging 0.80
R4946:Srsf12 UTSW 4 33231174 missense probably damaging 0.98
R5358:Srsf12 UTSW 4 33209330 missense probably damaging 0.99
R5802:Srsf12 UTSW 4 33230929 missense probably damaging 0.99
R6577:Srsf12 UTSW 4 33209196 unclassified probably benign
R7055:Srsf12 UTSW 4 33226157 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CGAAGCCCTGTCATGAGATC -3'
(R):5'- AATGGCACCCCAACAGCTTG -3'

Sequencing Primer
(F):5'- GAAGCCCTGTCATGAGATCTTTTTC -3'
(R):5'- CGGCATCGTCATCCAGAC -3'
Posted On2019-09-13