Incidental Mutation 'R7392:Agbl5'
ID573497
Institutional Source Beutler Lab
Gene Symbol Agbl5
Ensembl Gene ENSMUSG00000029165
Gene NameATP/GTP binding protein-like 5
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7392 (G1)
Quality Score225.009
Status Not validated
Chromosome5
Chromosomal Location30888694-30906965 bp(+) (GRCm38)
Type of Mutationcritical splice donor site (1 bp from exon)
DNA Base Change (assembly) G to A at 30890771 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000063228 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000069705] [ENSMUST00000114700] [ENSMUST00000200695] [ENSMUST00000200850] [ENSMUST00000201168] [ENSMUST00000201225] [ENSMUST00000201817] [ENSMUST00000201917] [ENSMUST00000202060] [ENSMUST00000202109]
Predicted Effect probably null
Transcript: ENSMUST00000069705
SMART Domains Protein: ENSMUSP00000063228
Gene: ENSMUSG00000029165

DomainStartEndE-ValueType
low complexity region 34 50 N/A INTRINSIC
Pfam:Peptidase_M14 191 361 8.4e-19 PFAM
low complexity region 384 399 N/A INTRINSIC
Blast:Zn_pept 424 489 4e-14 BLAST
low complexity region 538 548 N/A INTRINSIC
low complexity region 643 654 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000114700
SMART Domains Protein: ENSMUSP00000110348
Gene: ENSMUSG00000029165

DomainStartEndE-ValueType
low complexity region 34 50 N/A INTRINSIC
Pfam:Peptidase_M14 220 390 1.1e-18 PFAM
low complexity region 413 428 N/A INTRINSIC
Blast:Zn_pept 453 518 5e-14 BLAST
low complexity region 567 577 N/A INTRINSIC
low complexity region 672 683 N/A INTRINSIC
low complexity region 743 762 N/A INTRINSIC
low complexity region 766 787 N/A INTRINSIC
low complexity region 824 835 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000200695
SMART Domains Protein: ENSMUSP00000144109
Gene: ENSMUSG00000029165

DomainStartEndE-ValueType
low complexity region 34 50 N/A INTRINSIC
SCOP:d2ctc__ 148 177 5e-4 SMART
Predicted Effect probably null
Transcript: ENSMUST00000200850
SMART Domains Protein: ENSMUSP00000144274
Gene: ENSMUSG00000029165

DomainStartEndE-ValueType
low complexity region 34 50 N/A INTRINSIC
SCOP:d1jqga1 178 229 1e-4 SMART
Predicted Effect probably null
Transcript: ENSMUST00000201168
SMART Domains Protein: ENSMUSP00000143808
Gene: ENSMUSG00000029165

DomainStartEndE-ValueType
low complexity region 34 50 N/A INTRINSIC
Pfam:Peptidase_M14 196 370 7.3e-13 PFAM
low complexity region 384 399 N/A INTRINSIC
Blast:Zn_pept 424 489 5e-14 BLAST
low complexity region 538 548 N/A INTRINSIC
low complexity region 643 654 N/A INTRINSIC
low complexity region 714 733 N/A INTRINSIC
low complexity region 737 758 N/A INTRINSIC
low complexity region 836 847 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000201225
SMART Domains Protein: ENSMUSP00000143934
Gene: ENSMUSG00000029165

DomainStartEndE-ValueType
low complexity region 34 50 N/A INTRINSIC
Pfam:Peptidase_M14 196 373 5.9e-13 PFAM
low complexity region 384 399 N/A INTRINSIC
Blast:Zn_pept 424 489 5e-14 BLAST
low complexity region 538 548 N/A INTRINSIC
low complexity region 643 654 N/A INTRINSIC
low complexity region 714 733 N/A INTRINSIC
low complexity region 752 768 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000201817
SMART Domains Protein: ENSMUSP00000144304
Gene: ENSMUSG00000029165

DomainStartEndE-ValueType
low complexity region 34 50 N/A INTRINSIC
Pfam:Peptidase_M14 196 372 6.4e-13 PFAM
low complexity region 384 399 N/A INTRINSIC
Blast:Zn_pept 424 489 5e-14 BLAST
low complexity region 538 548 N/A INTRINSIC
low complexity region 643 654 N/A INTRINSIC
low complexity region 714 733 N/A INTRINSIC
low complexity region 737 758 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000201917
SMART Domains Protein: ENSMUSP00000144188
Gene: ENSMUSG00000029165

DomainStartEndE-ValueType
low complexity region 34 50 N/A INTRINSIC
Pfam:Peptidase_M14 196 372 6.5e-13 PFAM
low complexity region 384 399 N/A INTRINSIC
Blast:Zn_pept 424 489 5e-14 BLAST
low complexity region 538 548 N/A INTRINSIC
low complexity region 643 654 N/A INTRINSIC
low complexity region 714 733 N/A INTRINSIC
low complexity region 737 758 N/A INTRINSIC
low complexity region 795 806 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000202060
SMART Domains Protein: ENSMUSP00000144018
Gene: ENSMUSG00000029165

DomainStartEndE-ValueType
low complexity region 34 50 N/A INTRINSIC
Pfam:Peptidase_M14 196 373 5.9e-13 PFAM
low complexity region 384 399 N/A INTRINSIC
Blast:Zn_pept 424 489 5e-14 BLAST
low complexity region 538 548 N/A INTRINSIC
low complexity region 643 654 N/A INTRINSIC
low complexity region 714 733 N/A INTRINSIC
low complexity region 752 768 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000202109
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a metallocarboxypeptidase involved in protein deglutamylation and a member of the peptidase M14 family of proteins. The encoded protein has been described as a "dual-functional" deglutamylase that can remove glutamate residues from both carboxyl termini and side chains of protein substrates. This deglutamylase activity may be important in antiviral immunity. Mutations in this gene are associated with retinitis pigmentosa. [provided by RefSeq, Jul 2016]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit increased susceptibility to HSV or VACV infection. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 83 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610021A01Rik T A 7: 41,626,566 F564L probably damaging Het
4930539E08Rik A T 17: 28,908,377 D219E probably benign Het
9530053A07Rik C T 7: 28,164,372 T2523M possibly damaging Het
Abcc2 T C 19: 43,808,687 I499T probably damaging Het
Adamts13 C T 2: 26,989,324 R630C probably damaging Het
Adgrv1 A T 13: 81,560,689 F1199I probably damaging Het
Anks1b A G 10: 90,680,786 D881G possibly damaging Het
Arap2 A T 5: 62,698,385 S569R possibly damaging Het
Arhgap15 T C 2: 44,063,774 S171P possibly damaging Het
Arhgef11 G A 3: 87,717,175 probably null Het
Baz1a C A 12: 54,898,765 L1271F probably damaging Het
Bdnf A C 2: 109,723,930 K216N probably benign Het
Bmp7 C T 2: 172,870,205 D409N probably damaging Het
Cacna1c T A 6: 118,741,920 I390F Het
Chd8 A G 14: 52,232,855 S433P probably benign Het
Clrn2 A G 5: 45,463,909 E215G possibly damaging Het
Col19a1 T G 1: 24,534,034 D219A unknown Het
Col2a1 G A 15: 97,980,151 R1036* probably null Het
Copg1 T A 6: 87,890,275 V110D probably benign Het
Cpd C T 11: 76,801,779 G744D probably damaging Het
Crygs G A 16: 22,806,502 P63L probably benign Het
Dcn A G 10: 97,509,998 D224G probably damaging Het
Dnah7a T C 1: 53,501,661 E2518G probably benign Het
Efcab6 C A 15: 83,988,951 R197L probably benign Het
Efr3b T A 12: 3,969,588 Y723F probably benign Het
Enam A G 5: 88,501,664 N344S probably damaging Het
Erich4 A G 7: 25,615,676 I58T possibly damaging Het
Esrp1 A G 4: 11,338,809 V665A probably benign Het
Etf1 G A 18: 34,906,050 T388I probably benign Het
Faf1 A G 4: 109,794,843 T244A probably benign Het
Fam129a A G 1: 151,696,224 T307A probably damaging Het
Fbn1 T C 2: 125,343,924 D1610G probably damaging Het
Frem1 G T 4: 83,013,827 F212L probably benign Het
Fuom T A 7: 140,101,160 D85V probably damaging Het
Gcfc2 T C 6: 81,943,012 probably null Het
Gpr37 C T 6: 25,688,787 A104T probably benign Het
Hsp90ab1 G C 17: 45,569,048 T514S probably benign Het
Ifnl2 A G 7: 28,509,669 F74L probably benign Het
Ipo11 G A 13: 106,891,691 R367* probably null Het
Itpr2 T C 6: 146,359,340 D963G possibly damaging Het
Krt15 A T 11: 100,135,560 V100E possibly damaging Het
Lrch3 T A 16: 32,986,755 L466* probably null Het
Lrfn5 A T 12: 61,840,304 T293S probably benign Het
Lrp5 A G 19: 3,610,199 I955T probably damaging Het
Lrrc4b C T 7: 44,462,015 T437M probably damaging Het
Man1a A G 10: 53,919,187 Y657H probably damaging Het
Mapkap1 G T 2: 34,435,154 R94L probably damaging Het
Mtmr4 T A 11: 87,604,557 L480Q probably damaging Het
Mycbp2 T C 14: 103,152,191 I3504M probably damaging Het
Mycbp2 A T 14: 103,243,128 C1169S probably damaging Het
Myo15 T C 11: 60,505,976 S1455P Het
Nid2 A G 14: 19,768,656 D406G probably benign Het
Nrip2 A G 6: 128,404,950 I69V probably benign Het
Nthl1 G A 17: 24,638,624 V266I probably benign Het
Olfr1000 A C 2: 85,608,488 C141G possibly damaging Het
Olfr1061 A G 2: 86,413,152 V300A probably benign Het
Olfr1440 G T 19: 12,394,465 L67F probably damaging Het
Olfr1444 A G 19: 12,862,587 T271A probably benign Het
Olfr284 A G 15: 98,340,311 V226A probably benign Het
Olfr501-ps1 C A 7: 108,508,084 H9Q possibly damaging Het
Olfr698 T C 7: 106,753,382 E2G possibly damaging Het
Pcdhb1 A C 18: 37,265,118 S41R possibly damaging Het
Pdcd11 T A 19: 47,127,997 F1529I probably damaging Het
Plcd3 C A 11: 103,101,557 probably benign Het
Qdpr T C 5: 45,439,376 M149V probably benign Het
R3hcc1 T A 14: 69,705,880 probably null Het
Rasgrf2 T C 13: 91,893,737 Y392C Het
Slc8a3 A C 12: 81,314,803 V414G probably damaging Het
Slco1a6 A G 6: 142,157,277 S54P probably benign Het
Sos1 C A 17: 80,424,200 V624F probably damaging Het
Spdef T C 17: 27,717,288 D227G probably benign Het
Sptb G T 12: 76,624,229 Q447K probably damaging Het
Srsf12 A T 4: 33,209,265 R62W unknown Het
Stag3 T C 5: 138,291,366 L266P probably damaging Het
Sult2b1 T C 7: 45,742,438 probably benign Het
Taf1a A G 1: 183,409,276 T66A Het
Tfg A T 16: 56,712,609 probably null Het
Trim34b A G 7: 104,336,397 N413S probably benign Het
Txndc15 T A 13: 55,721,586 M184K probably damaging Het
Umodl1 A C 17: 30,982,332 S412R probably damaging Het
Zbtb8b T A 4: 129,432,890 M161L probably benign Het
Zfp597 A T 16: 3,866,505 V129E probably benign Het
Zfp790 T C 7: 29,828,625 I245T possibly damaging Het
Other mutations in Agbl5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01315:Agbl5 APN 5 30893234 missense probably benign 0.00
sausage UTSW 5 30894358 nonsense probably null
R0355:Agbl5 UTSW 5 30891991 critical splice donor site probably null
R0575:Agbl5 UTSW 5 30894454 missense probably damaging 1.00
R1694:Agbl5 UTSW 5 30893382 missense probably damaging 1.00
R1709:Agbl5 UTSW 5 30906241 missense probably damaging 1.00
R1829:Agbl5 UTSW 5 30903064 missense possibly damaging 0.66
R2434:Agbl5 UTSW 5 30894013 missense probably damaging 0.97
R3418:Agbl5 UTSW 5 30904723 missense probably damaging 1.00
R4827:Agbl5 UTSW 5 30895814 missense probably damaging 1.00
R4828:Agbl5 UTSW 5 30890715 missense probably damaging 1.00
R4830:Agbl5 UTSW 5 30890715 missense probably damaging 1.00
R5017:Agbl5 UTSW 5 30903059 missense probably damaging 1.00
R5018:Agbl5 UTSW 5 30903059 missense probably damaging 1.00
R5036:Agbl5 UTSW 5 30903059 missense probably damaging 1.00
R5038:Agbl5 UTSW 5 30903059 missense probably damaging 1.00
R5052:Agbl5 UTSW 5 30891214 missense possibly damaging 0.76
R5071:Agbl5 UTSW 5 30903059 missense probably damaging 1.00
R5073:Agbl5 UTSW 5 30903059 missense probably damaging 1.00
R5074:Agbl5 UTSW 5 30903059 missense probably damaging 1.00
R5081:Agbl5 UTSW 5 30903059 missense probably damaging 1.00
R5083:Agbl5 UTSW 5 30903059 missense probably damaging 1.00
R5103:Agbl5 UTSW 5 30894001 missense probably damaging 1.00
R5107:Agbl5 UTSW 5 30892478 missense probably damaging 1.00
R5130:Agbl5 UTSW 5 30903059 missense probably damaging 1.00
R5395:Agbl5 UTSW 5 30890338 missense probably damaging 1.00
R5522:Agbl5 UTSW 5 30893903 unclassified probably null
R5524:Agbl5 UTSW 5 30893903 unclassified probably null
R5526:Agbl5 UTSW 5 30893903 unclassified probably null
R5657:Agbl5 UTSW 5 30894046 missense probably damaging 1.00
R5790:Agbl5 UTSW 5 30894358 nonsense probably null
R6301:Agbl5 UTSW 5 30891833 missense probably damaging 1.00
R6891:Agbl5 UTSW 5 30895178 missense probably damaging 1.00
R6919:Agbl5 UTSW 5 30904717 missense probably benign 0.13
R7388:Agbl5 UTSW 5 30903239 nonsense probably null
R7410:Agbl5 UTSW 5 30890688 missense possibly damaging 0.94
R7452:Agbl5 UTSW 5 30893391 missense probably damaging 1.00
RF007:Agbl5 UTSW 5 30903245 missense unknown
Predicted Primers PCR Primer
(F):5'- GGCTCTCAGGTCATGGTTCTAC -3'
(R):5'- ATGCTGGGAACTGACCTCATG -3'

Sequencing Primer
(F):5'- TCAGGTCATGGTTCTACTTCAG -3'
(R):5'- GGGAACTGACCTCATGCCTCTC -3'
Posted On2019-09-13