Incidental Mutation 'R7392:9530053A07Rik'
ID 573511
Institutional Source Beutler Lab
Gene Symbol 9530053A07Rik
Ensembl Gene ENSMUSG00000078776
Gene Name RIKEN cDNA 9530053A07 gene
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.067) question?
Stock # R7392 (G1)
Quality Score 225.009
Status Not validated
Chromosome 7
Chromosomal Location 28129466-28164811 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to T at 28164372 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Threonine to Methionine at position 2523 (T2523M)
Ref Sequence ENSEMBL: ENSMUSP00000114986 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000059886] [ENSMUST00000150948]
AlphaFold E9PVG8
Predicted Effect possibly damaging
Transcript: ENSMUST00000059886
AA Change: T2523M

PolyPhen 2 Score 0.827 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000056479
Gene: ENSMUSG00000078776
AA Change: T2523M

DomainStartEndE-ValueType
low complexity region 8 24 N/A INTRINSIC
FOLN 27 49 1.23e-4 SMART
VWD 46 211 1.5e-40 SMART
C8 251 326 4.31e-33 SMART
Pfam:TIL 329 383 2e-13 PFAM
VWC 385 448 1.02e0 SMART
VWD 439 603 4.32e-32 SMART
C8 640 715 4.54e-9 SMART
Pfam:TIL 718 771 1.6e-12 PFAM
VWC 773 826 1.1e0 SMART
FOLN 805 827 6.87e1 SMART
VWD 825 988 7.92e-40 SMART
C8 1033 1108 5.1e-35 SMART
Pfam:TIL 1111 1164 7.6e-11 PFAM
VWC 1166 1224 1.1e-2 SMART
FOLN 1197 1219 9.55e-1 SMART
FOLN 1223 1245 5.38e1 SMART
VWD 1241 1410 9.04e-35 SMART
C8 1450 1526 9.54e-26 SMART
low complexity region 1540 1550 N/A INTRINSIC
EGF_like 1557 1580 5.34e1 SMART
VWC 1588 1681 3.21e-3 SMART
VWD 1639 1806 7.3e-30 SMART
C8 1838 1913 2.44e-32 SMART
EGF_like 1941 1964 4.46e1 SMART
VWC 1971 2062 2.85e-1 SMART
VWD 2022 2178 1.32e-27 SMART
low complexity region 2199 2212 N/A INTRINSIC
C8 2219 2294 1.43e-29 SMART
Pfam:TIL 2297 2350 1.1e-11 PFAM
FOLN 2383 2405 5.68e1 SMART
VWD 2402 2564 4.58e-4 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000150948
AA Change: T2523M

PolyPhen 2 Score 0.827 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000114986
Gene: ENSMUSG00000078776
AA Change: T2523M

DomainStartEndE-ValueType
low complexity region 8 24 N/A INTRINSIC
FOLN 27 49 1.23e-4 SMART
VWD 46 211 1.5e-40 SMART
C8 251 326 4.31e-33 SMART
Pfam:TIL 329 383 2e-13 PFAM
VWC 385 448 1.02e0 SMART
VWD 439 603 4.32e-32 SMART
C8 640 715 4.54e-9 SMART
Pfam:TIL 718 771 1.6e-12 PFAM
VWC 773 826 1.1e0 SMART
FOLN 805 827 6.87e1 SMART
VWD 825 988 7.92e-40 SMART
C8 1033 1108 5.1e-35 SMART
Pfam:TIL 1111 1164 7.6e-11 PFAM
VWC 1166 1224 1.1e-2 SMART
FOLN 1197 1219 9.55e-1 SMART
FOLN 1223 1245 5.38e1 SMART
VWD 1241 1410 9.04e-35 SMART
C8 1450 1526 9.54e-26 SMART
low complexity region 1540 1550 N/A INTRINSIC
EGF_like 1557 1580 5.34e1 SMART
VWC 1588 1681 3.21e-3 SMART
VWD 1639 1806 7.3e-30 SMART
C8 1838 1913 2.44e-32 SMART
EGF_like 1941 1964 4.46e1 SMART
VWC 1971 2062 2.85e-1 SMART
VWD 2022 2178 1.32e-27 SMART
low complexity region 2199 2212 N/A INTRINSIC
C8 2219 2294 1.43e-29 SMART
Pfam:TIL 2297 2350 1.1e-11 PFAM
FOLN 2383 2405 5.68e1 SMART
VWD 2402 2564 4.58e-4 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000207600
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 83 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610021A01Rik T A 7: 41,626,566 F564L probably damaging Het
4930539E08Rik A T 17: 28,908,377 D219E probably benign Het
Abcc2 T C 19: 43,808,687 I499T probably damaging Het
Adamts13 C T 2: 26,989,324 R630C probably damaging Het
Adgrv1 A T 13: 81,560,689 F1199I probably damaging Het
Agbl5 G A 5: 30,890,771 probably null Het
Anks1b A G 10: 90,680,786 D881G possibly damaging Het
Arap2 A T 5: 62,698,385 S569R possibly damaging Het
Arhgap15 T C 2: 44,063,774 S171P possibly damaging Het
Arhgef11 G A 3: 87,717,175 probably null Het
Baz1a C A 12: 54,898,765 L1271F probably damaging Het
Bdnf A C 2: 109,723,930 K216N probably benign Het
Bmp7 C T 2: 172,870,205 D409N probably damaging Het
Cacna1c T A 6: 118,741,920 I390F Het
Chd8 A G 14: 52,232,855 S433P probably benign Het
Clrn2 A G 5: 45,463,909 E215G possibly damaging Het
Col19a1 T G 1: 24,534,034 D219A unknown Het
Col2a1 G A 15: 97,980,151 R1036* probably null Het
Copg1 T A 6: 87,890,275 V110D probably benign Het
Cpd C T 11: 76,801,779 G744D probably damaging Het
Crygs G A 16: 22,806,502 P63L probably benign Het
Dcn A G 10: 97,509,998 D224G probably damaging Het
Dnah7a T C 1: 53,501,661 E2518G probably benign Het
Efcab6 C A 15: 83,988,951 R197L probably benign Het
Efr3b T A 12: 3,969,588 Y723F probably benign Het
Enam A G 5: 88,501,664 N344S probably damaging Het
Erich4 A G 7: 25,615,676 I58T possibly damaging Het
Esrp1 A G 4: 11,338,809 V665A probably benign Het
Etf1 G A 18: 34,906,050 T388I probably benign Het
Faf1 A G 4: 109,794,843 T244A probably benign Het
Fam129a A G 1: 151,696,224 T307A probably damaging Het
Fbn1 T C 2: 125,343,924 D1610G probably damaging Het
Frem1 G T 4: 83,013,827 F212L probably benign Het
Fuom T A 7: 140,101,160 D85V probably damaging Het
Gcfc2 T C 6: 81,943,012 probably null Het
Gpr37 C T 6: 25,688,787 A104T probably benign Het
Hsp90ab1 G C 17: 45,569,048 T514S probably benign Het
Ifnl2 A G 7: 28,509,669 F74L probably benign Het
Ipo11 G A 13: 106,891,691 R367* probably null Het
Itpr2 T C 6: 146,359,340 D963G possibly damaging Het
Krt15 A T 11: 100,135,560 V100E possibly damaging Het
Lrch3 T A 16: 32,986,755 L466* probably null Het
Lrfn5 A T 12: 61,840,304 T293S probably benign Het
Lrp5 A G 19: 3,610,199 I955T probably damaging Het
Lrrc4b C T 7: 44,462,015 T437M probably damaging Het
Man1a A G 10: 53,919,187 Y657H probably damaging Het
Mapkap1 G T 2: 34,435,154 R94L probably damaging Het
Mtmr4 T A 11: 87,604,557 L480Q probably damaging Het
Mycbp2 T C 14: 103,152,191 I3504M probably damaging Het
Mycbp2 A T 14: 103,243,128 C1169S probably damaging Het
Myo15 T C 11: 60,505,976 S1455P Het
Nid2 A G 14: 19,768,656 D406G probably benign Het
Nrip2 A G 6: 128,404,950 I69V probably benign Het
Nthl1 G A 17: 24,638,624 V266I probably benign Het
Olfr1000 A C 2: 85,608,488 C141G possibly damaging Het
Olfr1061 A G 2: 86,413,152 V300A probably benign Het
Olfr1440 G T 19: 12,394,465 L67F probably damaging Het
Olfr1444 A G 19: 12,862,587 T271A probably benign Het
Olfr284 A G 15: 98,340,311 V226A probably benign Het
Olfr501-ps1 C A 7: 108,508,084 H9Q possibly damaging Het
Olfr698 T C 7: 106,753,382 E2G possibly damaging Het
Pcdhb1 A C 18: 37,265,118 S41R possibly damaging Het
Pdcd11 T A 19: 47,127,997 F1529I probably damaging Het
Plcd3 C A 11: 103,101,557 probably benign Het
Qdpr T C 5: 45,439,376 M149V probably benign Het
R3hcc1 T A 14: 69,705,880 probably null Het
Rasgrf2 T C 13: 91,893,737 Y392C Het
Slc8a3 A C 12: 81,314,803 V414G probably damaging Het
Slco1a6 A G 6: 142,157,277 S54P probably benign Het
Sos1 C A 17: 80,424,200 V624F probably damaging Het
Spdef T C 17: 27,717,288 D227G probably benign Het
Sptb G T 12: 76,624,229 Q447K probably damaging Het
Srsf12 A T 4: 33,209,265 R62W unknown Het
Stag3 T C 5: 138,291,366 L266P probably damaging Het
Sult2b1 T C 7: 45,742,438 probably benign Het
Taf1a A G 1: 183,409,276 T66A Het
Tfg A T 16: 56,712,609 probably null Het
Trim34b A G 7: 104,336,397 N413S probably benign Het
Txndc15 T A 13: 55,721,586 M184K probably damaging Het
Umodl1 A C 17: 30,982,332 S412R probably damaging Het
Zbtb8b T A 4: 129,432,890 M161L probably benign Het
Zfp597 A T 16: 3,866,505 V129E probably benign Het
Zfp790 T C 7: 29,828,625 I245T possibly damaging Het
Other mutations in 9530053A07Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00435:9530053A07Rik APN 7 28164528 missense probably damaging 1.00
IGL00757:9530053A07Rik APN 7 28154445 missense probably damaging 1.00
IGL01015:9530053A07Rik APN 7 28155318 missense probably damaging 1.00
IGL01079:9530053A07Rik APN 7 28139778 missense probably damaging 0.99
IGL01343:9530053A07Rik APN 7 28150702 missense probably benign 0.19
IGL01420:9530053A07Rik APN 7 28140133 missense probably benign 0.28
IGL01604:9530053A07Rik APN 7 28155324 missense probably benign 0.11
IGL01666:9530053A07Rik APN 7 28153292 missense probably damaging 1.00
IGL02002:9530053A07Rik APN 7 28152796 missense probably damaging 1.00
IGL02036:9530053A07Rik APN 7 28137525 missense possibly damaging 0.82
IGL02126:9530053A07Rik APN 7 28139856 missense probably damaging 1.00
IGL02150:9530053A07Rik APN 7 28146779 nonsense probably null
IGL02219:9530053A07Rik APN 7 28154635 missense probably damaging 1.00
IGL02563:9530053A07Rik APN 7 28157892 missense probably benign
IGL02804:9530053A07Rik APN 7 28153370 missense probably benign 0.00
IGL02830:9530053A07Rik APN 7 28162923 missense probably damaging 1.00
IGL02943:9530053A07Rik APN 7 28147188 missense probably damaging 1.00
IGL02977:9530053A07Rik APN 7 28164372 missense possibly damaging 0.83
IGL03231:9530053A07Rik APN 7 28153722 missense possibly damaging 0.95
IGL03304:9530053A07Rik APN 7 28142242 missense probably damaging 0.99
herz UTSW 7 28153839 missense possibly damaging 0.72
pulse UTSW 7 28153749 missense probably damaging 1.00
Sinusoidal UTSW 7 28140130 missense probably damaging 1.00
PIT4378001:9530053A07Rik UTSW 7 28154464 missense possibly damaging 0.61
R0023:9530053A07Rik UTSW 7 28153412 missense probably benign 0.00
R0131:9530053A07Rik UTSW 7 28137615 missense probably damaging 1.00
R0131:9530053A07Rik UTSW 7 28137615 missense probably damaging 1.00
R0132:9530053A07Rik UTSW 7 28137615 missense probably damaging 1.00
R0158:9530053A07Rik UTSW 7 28155492 missense probably damaging 1.00
R0230:9530053A07Rik UTSW 7 28156825 missense probably damaging 1.00
R0310:9530053A07Rik UTSW 7 28142274 missense probably benign 0.04
R0448:9530053A07Rik UTSW 7 28140235 missense probably benign 0.03
R0462:9530053A07Rik UTSW 7 28137340 missense probably damaging 1.00
R0481:9530053A07Rik UTSW 7 28153749 missense probably damaging 1.00
R0497:9530053A07Rik UTSW 7 28147465 missense probably damaging 1.00
R0556:9530053A07Rik UTSW 7 28159378 missense probably benign
R0562:9530053A07Rik UTSW 7 28162690 missense probably benign 0.30
R0586:9530053A07Rik UTSW 7 28137091 missense probably damaging 0.99
R0924:9530053A07Rik UTSW 7 28140130 missense probably damaging 1.00
R0930:9530053A07Rik UTSW 7 28140130 missense probably damaging 1.00
R1103:9530053A07Rik UTSW 7 28154520 missense probably damaging 1.00
R1213:9530053A07Rik UTSW 7 28157673 missense probably damaging 1.00
R1292:9530053A07Rik UTSW 7 28142794 splice site probably benign
R1368:9530053A07Rik UTSW 7 28159478 missense possibly damaging 0.89
R1451:9530053A07Rik UTSW 7 28137157 missense probably damaging 1.00
R1477:9530053A07Rik UTSW 7 28157093 missense probably benign 0.01
R1538:9530053A07Rik UTSW 7 28155492 missense probably damaging 1.00
R1655:9530053A07Rik UTSW 7 28147110 missense probably damaging 0.98
R1697:9530053A07Rik UTSW 7 28154347 missense probably damaging 1.00
R1741:9530053A07Rik UTSW 7 28157854 missense probably damaging 0.98
R1796:9530053A07Rik UTSW 7 28155372 missense probably damaging 1.00
R1853:9530053A07Rik UTSW 7 28155546 nonsense probably null
R1861:9530053A07Rik UTSW 7 28154732 missense probably damaging 1.00
R1909:9530053A07Rik UTSW 7 28144348 missense possibly damaging 0.52
R1971:9530053A07Rik UTSW 7 28131512 missense possibly damaging 0.90
R1990:9530053A07Rik UTSW 7 28154360 missense probably damaging 0.98
R2020:9530053A07Rik UTSW 7 28155594 missense probably benign
R2084:9530053A07Rik UTSW 7 28157535 missense probably damaging 1.00
R2125:9530053A07Rik UTSW 7 28158022 missense probably benign 0.00
R2132:9530053A07Rik UTSW 7 28155474 missense probably damaging 1.00
R2513:9530053A07Rik UTSW 7 28131635 missense probably damaging 0.99
R2913:9530053A07Rik UTSW 7 28164307 missense probably damaging 1.00
R3150:9530053A07Rik UTSW 7 28154195 missense probably benign 0.21
R3499:9530053A07Rik UTSW 7 28154555 missense probably benign 0.42
R3702:9530053A07Rik UTSW 7 28157778 missense probably damaging 1.00
R3881:9530053A07Rik UTSW 7 28140038 nonsense probably null
R3938:9530053A07Rik UTSW 7 28154294 missense probably damaging 1.00
R4050:9530053A07Rik UTSW 7 28152985 missense possibly damaging 0.55
R4152:9530053A07Rik UTSW 7 28156897 missense possibly damaging 0.47
R4168:9530053A07Rik UTSW 7 28137109 missense probably benign 0.05
R4235:9530053A07Rik UTSW 7 28156648 missense probably damaging 0.99
R4241:9530053A07Rik UTSW 7 28154335 missense probably damaging 1.00
R4363:9530053A07Rik UTSW 7 28146906 missense probably damaging 1.00
R4460:9530053A07Rik UTSW 7 28152856 missense probably benign 0.17
R4463:9530053A07Rik UTSW 7 28150719 missense probably benign
R4841:9530053A07Rik UTSW 7 28150722 missense probably damaging 1.00
R4842:9530053A07Rik UTSW 7 28150722 missense probably damaging 1.00
R4876:9530053A07Rik UTSW 7 28142800 intron probably benign
R4905:9530053A07Rik UTSW 7 28156983 missense possibly damaging 0.93
R4997:9530053A07Rik UTSW 7 28143924 missense possibly damaging 0.77
R5091:9530053A07Rik UTSW 7 28156958 missense probably benign 0.44
R5159:9530053A07Rik UTSW 7 28153308 missense probably benign 0.09
R5326:9530053A07Rik UTSW 7 28155489 missense probably damaging 0.98
R5396:9530053A07Rik UTSW 7 28140183 missense probably benign
R5441:9530053A07Rik UTSW 7 28156914 missense probably damaging 1.00
R5480:9530053A07Rik UTSW 7 28157999 nonsense probably null
R5542:9530053A07Rik UTSW 7 28155489 missense probably damaging 0.98
R5571:9530053A07Rik UTSW 7 28156569 missense probably damaging 0.99
R5613:9530053A07Rik UTSW 7 28142878 intron probably benign
R5637:9530053A07Rik UTSW 7 28152852 missense probably benign 0.00
R5766:9530053A07Rik UTSW 7 28137329 nonsense probably null
R6174:9530053A07Rik UTSW 7 28139959 missense probably damaging 0.96
R6233:9530053A07Rik UTSW 7 28131460 missense probably damaging 0.99
R6250:9530053A07Rik UTSW 7 28150714 missense probably damaging 1.00
R6379:9530053A07Rik UTSW 7 28157592 missense probably damaging 1.00
R6442:9530053A07Rik UTSW 7 28144186 missense possibly damaging 0.88
R6478:9530053A07Rik UTSW 7 28155373 missense probably damaging 1.00
R6699:9530053A07Rik UTSW 7 28144368 missense probably damaging 1.00
R6852:9530053A07Rik UTSW 7 28147135 missense probably damaging 1.00
R6883:9530053A07Rik UTSW 7 28152835 missense possibly damaging 0.89
R6902:9530053A07Rik UTSW 7 28137213 missense probably damaging 1.00
R6903:9530053A07Rik UTSW 7 28137213 missense probably damaging 1.00
R6904:9530053A07Rik UTSW 7 28137213 missense probably damaging 1.00
R6992:9530053A07Rik UTSW 7 28140183 missense probably benign 0.04
R7023:9530053A07Rik UTSW 7 28140038 nonsense probably null
R7039:9530053A07Rik UTSW 7 28140148 missense possibly damaging 0.80
R7171:9530053A07Rik UTSW 7 28154519 nonsense probably null
R7282:9530053A07Rik UTSW 7 28144408 missense probably benign 0.02
R7291:9530053A07Rik UTSW 7 28140220 missense probably benign
R7344:9530053A07Rik UTSW 7 28140279 missense possibly damaging 0.79
R7344:9530053A07Rik UTSW 7 28152760 missense possibly damaging 0.46
R7531:9530053A07Rik UTSW 7 28140231 missense probably benign
R7541:9530053A07Rik UTSW 7 28144256 nonsense probably null
R7577:9530053A07Rik UTSW 7 28154423 missense possibly damaging 0.65
R7594:9530053A07Rik UTSW 7 28131460 missense probably damaging 0.99
R7647:9530053A07Rik UTSW 7 28140045 missense probably benign 0.00
R7718:9530053A07Rik UTSW 7 28147201 missense probably damaging 1.00
R7733:9530053A07Rik UTSW 7 28139965 missense probably damaging 1.00
R7737:9530053A07Rik UTSW 7 28157073 missense probably damaging 1.00
R7908:9530053A07Rik UTSW 7 28147496 missense probably benign 0.12
R8013:9530053A07Rik UTSW 7 28137541 missense probably benign 0.14
R8014:9530053A07Rik UTSW 7 28137541 missense probably benign 0.14
R8151:9530053A07Rik UTSW 7 28153341 missense possibly damaging 0.95
R8175:9530053A07Rik UTSW 7 28164448 nonsense probably null
R8254:9530053A07Rik UTSW 7 28147349 missense possibly damaging 0.63
R8345:9530053A07Rik UTSW 7 28155360 missense probably damaging 1.00
R8414:9530053A07Rik UTSW 7 28142733 missense probably damaging 1.00
R8419:9530053A07Rik UTSW 7 28143921 missense probably damaging 1.00
R8496:9530053A07Rik UTSW 7 28143952 missense possibly damaging 0.81
R8691:9530053A07Rik UTSW 7 28153839 missense possibly damaging 0.72
R8785:9530053A07Rik UTSW 7 28154707 missense probably damaging 1.00
R8863:9530053A07Rik UTSW 7 28131581 missense probably damaging 1.00
R8926:9530053A07Rik UTSW 7 28154444 missense probably damaging 1.00
R8950:9530053A07Rik UTSW 7 28164326 missense probably benign 0.32
R9014:9530053A07Rik UTSW 7 28155451 missense probably damaging 1.00
R9045:9530053A07Rik UTSW 7 28154431 missense probably damaging 1.00
R9115:9530053A07Rik UTSW 7 28154329 missense possibly damaging 0.74
R9233:9530053A07Rik UTSW 7 28140094 missense possibly damaging 0.83
R9330:9530053A07Rik UTSW 7 28156985 missense probably benign 0.02
R9426:9530053A07Rik UTSW 7 28143856 missense possibly damaging 0.92
Z1176:9530053A07Rik UTSW 7 28142386 missense probably benign 0.06
Z1176:9530053A07Rik UTSW 7 28154762 missense probably benign 0.03
Z1177:9530053A07Rik UTSW 7 28139898 missense probably benign 0.25
Z1186:9530053A07Rik UTSW 7 28131572 missense probably benign
Z1186:9530053A07Rik UTSW 7 28146705 missense probably benign 0.00
Z1186:9530053A07Rik UTSW 7 28156986 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TTGAACCTTTGCTGTGCACG -3'
(R):5'- CCAAAGTCTGGCCTCCATTC -3'

Sequencing Primer
(F):5'- AGGACTCCAGCCTTGGTGATC -3'
(R):5'- CTCCATCCTCACCATGGGG -3'
Posted On 2019-09-13