Incidental Mutation 'R7392:Myo15a'
ID 573524
Institutional Source Beutler Lab
Gene Symbol Myo15a
Ensembl Gene ENSMUSG00000042678
Gene Name myosin XVA
Synonyms Myo15
MMRRC Submission 045474-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R7392 (G1)
Quality Score 225.009
Status Not validated
Chromosome 11
Chromosomal Location 60360165-60419195 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 60396802 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Proline at position 1455 (S1455P)
Gene Model predicted gene model for transcript(s): [ENSMUST00000071880] [ENSMUST00000081823] [ENSMUST00000094135]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000071880
AA Change: S2642P

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000071777
Gene: ENSMUSG00000042678
AA Change: S2642P

DomainStartEndE-ValueType
low complexity region 4 24 N/A INTRINSIC
low complexity region 87 100 N/A INTRINSIC
low complexity region 107 120 N/A INTRINSIC
low complexity region 269 292 N/A INTRINSIC
low complexity region 295 306 N/A INTRINSIC
low complexity region 311 325 N/A INTRINSIC
low complexity region 349 384 N/A INTRINSIC
low complexity region 425 435 N/A INTRINSIC
low complexity region 487 498 N/A INTRINSIC
low complexity region 502 509 N/A INTRINSIC
low complexity region 653 681 N/A INTRINSIC
low complexity region 692 705 N/A INTRINSIC
low complexity region 737 747 N/A INTRINSIC
low complexity region 758 775 N/A INTRINSIC
low complexity region 781 792 N/A INTRINSIC
low complexity region 796 809 N/A INTRINSIC
low complexity region 825 849 N/A INTRINSIC
low complexity region 883 897 N/A INTRINSIC
low complexity region 1067 1082 N/A INTRINSIC
low complexity region 1115 1130 N/A INTRINSIC
MYSc 1200 1884 N/A SMART
IQ 1885 1907 1.63e-1 SMART
IQ 1908 1930 1.77e-2 SMART
IQ 1931 1953 2.97e2 SMART
low complexity region 1955 1974 N/A INTRINSIC
low complexity region 1992 2006 N/A INTRINSIC
MyTH4 2049 2195 1.8e-42 SMART
low complexity region 2396 2405 N/A INTRINSIC
low complexity region 2451 2461 N/A INTRINSIC
Blast:MYSc 2665 2848 2e-14 BLAST
SH3 2851 2933 1.55e-4 SMART
low complexity region 2949 2962 N/A INTRINSIC
MyTH4 3031 3185 5.59e-48 SMART
B41 3188 3400 6.94e-3 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000081823
AA Change: S1437P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000080507
Gene: ENSMUSG00000042678
AA Change: S1437P

DomainStartEndE-ValueType
MYSc 13 697 N/A SMART
IQ 698 720 1.63e-1 SMART
IQ 721 743 1.77e-2 SMART
IQ 744 766 2.97e2 SMART
low complexity region 787 801 N/A INTRINSIC
MyTH4 844 990 1.8e-42 SMART
low complexity region 1191 1200 N/A INTRINSIC
low complexity region 1246 1256 N/A INTRINSIC
Blast:MYSc 1460 1643 7e-15 BLAST
SH3 1646 1728 1.55e-4 SMART
low complexity region 1744 1757 N/A INTRINSIC
MyTH4 1826 1980 5.59e-48 SMART
B41 1983 2195 6.94e-3 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000094135
AA Change: S2624P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000091686
Gene: ENSMUSG00000042678
AA Change: S2624P

DomainStartEndE-ValueType
low complexity region 4 24 N/A INTRINSIC
low complexity region 87 100 N/A INTRINSIC
low complexity region 107 120 N/A INTRINSIC
low complexity region 269 292 N/A INTRINSIC
low complexity region 295 306 N/A INTRINSIC
low complexity region 311 325 N/A INTRINSIC
low complexity region 349 384 N/A INTRINSIC
low complexity region 425 435 N/A INTRINSIC
low complexity region 487 498 N/A INTRINSIC
low complexity region 502 509 N/A INTRINSIC
low complexity region 653 681 N/A INTRINSIC
low complexity region 692 705 N/A INTRINSIC
low complexity region 737 747 N/A INTRINSIC
low complexity region 758 775 N/A INTRINSIC
low complexity region 781 792 N/A INTRINSIC
low complexity region 796 809 N/A INTRINSIC
low complexity region 825 849 N/A INTRINSIC
low complexity region 883 897 N/A INTRINSIC
low complexity region 1067 1082 N/A INTRINSIC
low complexity region 1115 1130 N/A INTRINSIC
MYSc 1200 1884 N/A SMART
IQ 1885 1907 1.63e-1 SMART
IQ 1908 1930 1.77e-2 SMART
IQ 1931 1953 2.97e2 SMART
low complexity region 1974 1988 N/A INTRINSIC
MyTH4 2031 2177 1.8e-42 SMART
low complexity region 2378 2387 N/A INTRINSIC
low complexity region 2433 2443 N/A INTRINSIC
Blast:MYSc 2647 2830 2e-14 BLAST
SH3 2833 2915 1.55e-4 SMART
low complexity region 2931 2944 N/A INTRINSIC
MyTH4 3013 3167 5.59e-48 SMART
B41 3170 3382 6.94e-3 SMART
Predicted Effect
SMART Domains Protein: ENSMUSP00000120839
Gene: ENSMUSG00000042678
AA Change: S1455P

DomainStartEndE-ValueType
MYSc 34 716 N/A SMART
IQ 717 739 1.63e-1 SMART
IQ 740 762 1.77e-2 SMART
IQ 763 785 2.97e2 SMART
low complexity region 806 820 N/A INTRINSIC
MyTH4 863 1009 1.8e-42 SMART
low complexity region 1210 1219 N/A INTRINSIC
low complexity region 1265 1275 N/A INTRINSIC
Blast:MYSc 1479 1662 5e-15 BLAST
SH3 1665 1747 1.55e-4 SMART
low complexity region 1763 1776 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an unconventional myosin. This protein differs from other myosins in that it has a long N-terminal extension preceding the conserved motor domain. Studies in mice suggest that this protein is necessary for actin organization in the hair cells of the cochlea. Mutations in this gene have been associated with profound, congenital, neurosensory, nonsyndromal deafness. This gene is located within the Smith-Magenis syndrome region on chromosome 17. Read-through transcripts containing an upstream gene and this gene have been identified, but they are not thought to encode a fusion protein. Several alternatively spliced transcript variants have been described, but their full length sequences have not been determined. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mutations in this gene result in profound deafness and neurological behavior. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 83 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610021A01Rik T A 7: 41,275,990 (GRCm39) F564L probably damaging Het
Abcc2 T C 19: 43,797,126 (GRCm39) I499T probably damaging Het
Adamts13 C T 2: 26,879,336 (GRCm39) R630C probably damaging Het
Adgrv1 A T 13: 81,708,808 (GRCm39) F1199I probably damaging Het
Agbl5 G A 5: 31,048,115 (GRCm39) probably null Het
Anks1b A G 10: 90,516,648 (GRCm39) D881G possibly damaging Het
Arap2 A T 5: 62,855,728 (GRCm39) S569R possibly damaging Het
Arhgap15 T C 2: 43,953,786 (GRCm39) S171P possibly damaging Het
Arhgef11 G A 3: 87,624,482 (GRCm39) probably null Het
Baz1a C A 12: 54,945,550 (GRCm39) L1271F probably damaging Het
Bdnf A C 2: 109,554,275 (GRCm39) K216N probably benign Het
Bmp7 C T 2: 172,711,998 (GRCm39) D409N probably damaging Het
Bnip5 A T 17: 29,127,351 (GRCm39) D219E probably benign Het
Cacna1c T A 6: 118,718,881 (GRCm39) I390F Het
Chd8 A G 14: 52,470,312 (GRCm39) S433P probably benign Het
Clrn2 A G 5: 45,621,251 (GRCm39) E215G possibly damaging Het
Col19a1 T G 1: 24,573,115 (GRCm39) D219A unknown Het
Col2a1 G A 15: 97,878,032 (GRCm39) R1036* probably null Het
Copg1 T A 6: 87,867,257 (GRCm39) V110D probably benign Het
Cpd C T 11: 76,692,605 (GRCm39) G744D probably damaging Het
Crygs G A 16: 22,625,252 (GRCm39) P63L probably benign Het
Dcn A G 10: 97,345,860 (GRCm39) D224G probably damaging Het
Dnah7a T C 1: 53,540,820 (GRCm39) E2518G probably benign Het
Efcab6 C A 15: 83,873,152 (GRCm39) R197L probably benign Het
Efr3b T A 12: 4,019,588 (GRCm39) Y723F probably benign Het
Enam A G 5: 88,649,523 (GRCm39) N344S probably damaging Het
Erich4 A G 7: 25,315,101 (GRCm39) I58T possibly damaging Het
Esrp1 A G 4: 11,338,809 (GRCm39) V665A probably benign Het
Etf1 G A 18: 35,039,103 (GRCm39) T388I probably benign Het
Faf1 A G 4: 109,652,040 (GRCm39) T244A probably benign Het
Fbn1 T C 2: 125,185,844 (GRCm39) D1610G probably damaging Het
Fcgbpl1 C T 7: 27,863,797 (GRCm39) T2523M possibly damaging Het
Frem1 G T 4: 82,932,064 (GRCm39) F212L probably benign Het
Fuom T A 7: 139,681,073 (GRCm39) D85V probably damaging Het
Gcfc2 T C 6: 81,919,993 (GRCm39) probably null Het
Gpr37 C T 6: 25,688,786 (GRCm39) A104T probably benign Het
Hsp90ab1 G C 17: 45,879,974 (GRCm39) T514S probably benign Het
Ifnl2 A G 7: 28,209,094 (GRCm39) F74L probably benign Het
Ipo11 G A 13: 107,028,199 (GRCm39) R367* probably null Het
Itpr2 T C 6: 146,260,838 (GRCm39) D963G possibly damaging Het
Krt15 A T 11: 100,026,386 (GRCm39) V100E possibly damaging Het
Lrch3 T A 16: 32,807,125 (GRCm39) L466* probably null Het
Lrfn5 A T 12: 61,887,090 (GRCm39) T293S probably benign Het
Lrp5 A G 19: 3,660,199 (GRCm39) I955T probably damaging Het
Lrrc4b C T 7: 44,111,439 (GRCm39) T437M probably damaging Het
Man1a A G 10: 53,795,283 (GRCm39) Y657H probably damaging Het
Mapkap1 G T 2: 34,325,166 (GRCm39) R94L probably damaging Het
Mtmr4 T A 11: 87,495,383 (GRCm39) L480Q probably damaging Het
Mycbp2 T C 14: 103,389,627 (GRCm39) I3504M probably damaging Het
Mycbp2 A T 14: 103,480,564 (GRCm39) C1169S probably damaging Het
Niban1 A G 1: 151,571,975 (GRCm39) T307A probably damaging Het
Nid2 A G 14: 19,818,724 (GRCm39) D406G probably benign Het
Nrip2 A G 6: 128,381,913 (GRCm39) I69V probably benign Het
Nthl1 G A 17: 24,857,598 (GRCm39) V266I probably benign Het
Or2ag16 T C 7: 106,352,589 (GRCm39) E2G possibly damaging Het
Or5an6 G T 19: 12,371,829 (GRCm39) L67F probably damaging Het
Or5b21 A G 19: 12,839,951 (GRCm39) T271A probably benign Het
Or5g23 A C 2: 85,438,832 (GRCm39) C141G possibly damaging Het
Or5p75-ps1 C A 7: 108,107,291 (GRCm39) H9Q possibly damaging Het
Or8k25 A G 2: 86,243,496 (GRCm39) V300A probably benign Het
Or8s5 A G 15: 98,238,192 (GRCm39) V226A probably benign Het
Pcdhb1 A C 18: 37,398,171 (GRCm39) S41R possibly damaging Het
Pdcd11 T A 19: 47,116,436 (GRCm39) F1529I probably damaging Het
Plcd3 C A 11: 102,992,383 (GRCm39) probably benign Het
Qdpr T C 5: 45,596,718 (GRCm39) M149V probably benign Het
R3hcc1 T A 14: 69,943,329 (GRCm39) probably null Het
Rasgrf2 T C 13: 92,041,856 (GRCm39) Y392C Het
Slc8a3 A C 12: 81,361,577 (GRCm39) V414G probably damaging Het
Slco1a6 A G 6: 142,103,003 (GRCm39) S54P probably benign Het
Sos1 C A 17: 80,731,629 (GRCm39) V624F probably damaging Het
Spdef T C 17: 27,936,262 (GRCm39) D227G probably benign Het
Sptb G T 12: 76,671,003 (GRCm39) Q447K probably damaging Het
Srsf12 A T 4: 33,209,265 (GRCm39) R62W unknown Het
Stag3 T C 5: 138,289,628 (GRCm39) L266P probably damaging Het
Sult2b1 T C 7: 45,391,862 (GRCm39) probably benign Het
Taf1a A G 1: 183,190,095 (GRCm39) T66A Het
Tfg A T 16: 56,532,972 (GRCm39) probably null Het
Trim34b A G 7: 103,985,604 (GRCm39) N413S probably benign Het
Txndc15 T A 13: 55,869,399 (GRCm39) M184K probably damaging Het
Umodl1 A C 17: 31,201,306 (GRCm39) S412R probably damaging Het
Zbtb8b T A 4: 129,326,683 (GRCm39) M161L probably benign Het
Zfp597 A T 16: 3,684,369 (GRCm39) V129E probably benign Het
Zfp790 T C 7: 29,528,050 (GRCm39) I245T possibly damaging Het
Other mutations in Myo15a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00845:Myo15a APN 11 60,368,605 (GRCm39) missense probably damaging 1.00
IGL01011:Myo15a APN 11 60,367,818 (GRCm39) missense probably benign 0.33
IGL01100:Myo15a APN 11 60,401,984 (GRCm39) missense probably damaging 1.00
IGL01357:Myo15a APN 11 60,393,115 (GRCm39) splice site probably benign
IGL01634:Myo15a APN 11 60,386,298 (GRCm39) missense probably damaging 1.00
IGL01763:Myo15a APN 11 60,412,564 (GRCm39) missense probably benign 0.07
IGL01901:Myo15a APN 11 60,418,260 (GRCm39) utr 3 prime probably benign
IGL01931:Myo15a APN 11 60,386,964 (GRCm39) missense probably damaging 1.00
IGL02006:Myo15a APN 11 60,401,954 (GRCm39) missense probably damaging 1.00
IGL02041:Myo15a APN 11 60,397,689 (GRCm39) missense probably damaging 0.99
IGL02094:Myo15a APN 11 60,401,473 (GRCm39) unclassified probably benign
IGL02122:Myo15a APN 11 60,374,292 (GRCm39) missense probably benign 0.23
IGL02153:Myo15a APN 11 60,389,223 (GRCm39) missense probably damaging 1.00
IGL02328:Myo15a APN 11 60,417,433 (GRCm39) missense probably benign 0.13
IGL02330:Myo15a APN 11 60,367,987 (GRCm39) missense possibly damaging 0.94
IGL02431:Myo15a APN 11 60,401,465 (GRCm39) missense possibly damaging 0.73
IGL02639:Myo15a APN 11 60,369,447 (GRCm39) missense probably benign
IGL02659:Myo15a APN 11 60,382,609 (GRCm39) splice site probably benign
IGL02800:Myo15a APN 11 60,393,195 (GRCm39) missense probably damaging 1.00
IGL02812:Myo15a APN 11 60,368,005 (GRCm39) missense probably benign 0.15
IGL02863:Myo15a APN 11 60,368,953 (GRCm39) missense probably damaging 1.00
IGL02873:Myo15a APN 11 60,374,308 (GRCm39) missense probably damaging 1.00
IGL02990:Myo15a APN 11 60,370,266 (GRCm39) missense probably benign 0.02
IGL03011:Myo15a APN 11 60,400,357 (GRCm39) splice site probably benign
IGL03243:Myo15a APN 11 60,387,344 (GRCm39) missense probably damaging 1.00
IGL03297:Myo15a APN 11 60,369,967 (GRCm39) missense probably damaging 1.00
novichok UTSW 11 60,372,566 (GRCm39) critical splice donor site probably null
parker UTSW 11 60,411,740 (GRCm39) critical splice donor site probably null
Typhoon UTSW 11 60,378,251 (GRCm39) critical splice donor site probably null
PIT4131001:Myo15a UTSW 11 60,386,280 (GRCm39) missense probably damaging 1.00
PIT4131001:Myo15a UTSW 11 60,373,953 (GRCm39) missense probably damaging 1.00
R0133:Myo15a UTSW 11 60,368,676 (GRCm39) missense possibly damaging 0.94
R0265:Myo15a UTSW 11 60,405,723 (GRCm39) critical splice acceptor site probably null
R0389:Myo15a UTSW 11 60,369,364 (GRCm39) missense probably benign
R0416:Myo15a UTSW 11 60,402,000 (GRCm39) missense probably damaging 1.00
R0449:Myo15a UTSW 11 60,400,422 (GRCm39) missense possibly damaging 0.92
R0477:Myo15a UTSW 11 60,411,740 (GRCm39) critical splice donor site probably null
R0543:Myo15a UTSW 11 60,369,877 (GRCm39) missense probably benign
R0546:Myo15a UTSW 11 60,397,139 (GRCm39) missense probably damaging 1.00
R0555:Myo15a UTSW 11 60,412,464 (GRCm39) missense probably damaging 1.00
R0639:Myo15a UTSW 11 60,370,162 (GRCm39) missense probably benign 0.12
R0723:Myo15a UTSW 11 60,369,803 (GRCm39) missense possibly damaging 0.94
R0837:Myo15a UTSW 11 60,378,077 (GRCm39) missense probably damaging 0.98
R0865:Myo15a UTSW 11 60,382,514 (GRCm39) missense probably damaging 1.00
R0899:Myo15a UTSW 11 60,368,011 (GRCm39) missense possibly damaging 0.87
R1022:Myo15a UTSW 11 60,370,442 (GRCm39) missense probably benign 0.00
R1024:Myo15a UTSW 11 60,370,442 (GRCm39) missense probably benign 0.00
R1035:Myo15a UTSW 11 60,401,384 (GRCm39) unclassified probably benign
R1109:Myo15a UTSW 11 60,383,892 (GRCm39) missense probably damaging 1.00
R1170:Myo15a UTSW 11 60,370,233 (GRCm39) missense probably benign 0.04
R1241:Myo15a UTSW 11 60,390,256 (GRCm39) missense possibly damaging 0.58
R1392:Myo15a UTSW 11 60,368,800 (GRCm39) missense possibly damaging 0.95
R1392:Myo15a UTSW 11 60,368,800 (GRCm39) missense possibly damaging 0.95
R1434:Myo15a UTSW 11 60,395,157 (GRCm39) missense probably benign 0.00
R1450:Myo15a UTSW 11 60,386,308 (GRCm39) missense probably damaging 1.00
R1456:Myo15a UTSW 11 60,399,028 (GRCm39) missense probably damaging 1.00
R1468:Myo15a UTSW 11 60,396,832 (GRCm39) missense probably damaging 1.00
R1468:Myo15a UTSW 11 60,396,832 (GRCm39) missense probably damaging 1.00
R1548:Myo15a UTSW 11 60,379,064 (GRCm39) missense probably damaging 1.00
R1551:Myo15a UTSW 11 60,383,791 (GRCm39) missense possibly damaging 0.70
R1571:Myo15a UTSW 11 60,409,290 (GRCm39) missense probably damaging 1.00
R1662:Myo15a UTSW 11 60,392,527 (GRCm39) missense probably damaging 1.00
R1777:Myo15a UTSW 11 60,405,762 (GRCm39) missense probably benign
R1778:Myo15a UTSW 11 60,369,238 (GRCm39) missense possibly damaging 0.57
R1847:Myo15a UTSW 11 60,390,321 (GRCm39) nonsense probably null
R1875:Myo15a UTSW 11 60,398,354 (GRCm39) missense probably damaging 0.99
R1944:Myo15a UTSW 11 60,392,909 (GRCm39) missense probably damaging 0.99
R1945:Myo15a UTSW 11 60,392,909 (GRCm39) missense probably damaging 0.99
R2013:Myo15a UTSW 11 60,385,057 (GRCm39) missense probably damaging 1.00
R2107:Myo15a UTSW 11 60,382,636 (GRCm39) missense probably damaging 1.00
R2108:Myo15a UTSW 11 60,382,636 (GRCm39) missense probably damaging 1.00
R2112:Myo15a UTSW 11 60,384,994 (GRCm39) missense probably damaging 0.99
R2147:Myo15a UTSW 11 60,401,055 (GRCm39) missense possibly damaging 0.66
R2196:Myo15a UTSW 11 60,400,847 (GRCm39) nonsense probably null
R2207:Myo15a UTSW 11 60,396,860 (GRCm39) missense probably benign 0.01
R2245:Myo15a UTSW 11 60,399,925 (GRCm39) missense probably damaging 1.00
R2367:Myo15a UTSW 11 60,408,064 (GRCm39) missense probably damaging 0.99
R2374:Myo15a UTSW 11 60,369,669 (GRCm39) missense possibly damaging 0.88
R2438:Myo15a UTSW 11 60,373,878 (GRCm39) missense probably damaging 1.00
R3154:Myo15a UTSW 11 60,370,186 (GRCm39) splice site probably null
R3423:Myo15a UTSW 11 60,401,126 (GRCm39) critical splice donor site probably null
R3551:Myo15a UTSW 11 60,400,489 (GRCm39) missense possibly damaging 0.93
R3552:Myo15a UTSW 11 60,400,489 (GRCm39) missense possibly damaging 0.93
R3612:Myo15a UTSW 11 60,368,505 (GRCm39) missense probably damaging 1.00
R3620:Myo15a UTSW 11 60,369,468 (GRCm39) missense possibly damaging 0.63
R3713:Myo15a UTSW 11 60,370,057 (GRCm39) missense possibly damaging 0.55
R3714:Myo15a UTSW 11 60,370,057 (GRCm39) missense possibly damaging 0.55
R3715:Myo15a UTSW 11 60,370,057 (GRCm39) missense possibly damaging 0.55
R3783:Myo15a UTSW 11 60,368,398 (GRCm39) missense probably damaging 0.97
R3784:Myo15a UTSW 11 60,368,398 (GRCm39) missense probably damaging 0.97
R3785:Myo15a UTSW 11 60,368,398 (GRCm39) missense probably damaging 0.97
R3786:Myo15a UTSW 11 60,368,398 (GRCm39) missense probably damaging 0.97
R3787:Myo15a UTSW 11 60,368,398 (GRCm39) missense probably damaging 0.97
R3894:Myo15a UTSW 11 60,395,145 (GRCm39) missense probably benign 0.00
R3962:Myo15a UTSW 11 60,370,654 (GRCm39) missense probably benign 0.00
R4082:Myo15a UTSW 11 60,378,022 (GRCm39) missense possibly damaging 0.92
R4555:Myo15a UTSW 11 60,387,763 (GRCm39) missense probably damaging 1.00
R4641:Myo15a UTSW 11 60,393,867 (GRCm39) missense probably damaging 1.00
R4665:Myo15a UTSW 11 60,395,705 (GRCm39) critical splice acceptor site probably null
R4713:Myo15a UTSW 11 60,370,756 (GRCm39) missense probably benign 0.21
R4820:Myo15a UTSW 11 60,367,741 (GRCm39) missense probably damaging 0.98
R5013:Myo15a UTSW 11 60,382,493 (GRCm39) missense probably damaging 1.00
R5051:Myo15a UTSW 11 60,378,251 (GRCm39) critical splice donor site probably null
R5187:Myo15a UTSW 11 60,394,440 (GRCm39) missense probably damaging 1.00
R5230:Myo15a UTSW 11 60,393,674 (GRCm39) missense possibly damaging 0.68
R5277:Myo15a UTSW 11 60,367,940 (GRCm39) nonsense probably null
R5345:Myo15a UTSW 11 60,388,364 (GRCm39) missense probably damaging 0.99
R5349:Myo15a UTSW 11 60,384,409 (GRCm39) missense probably damaging 1.00
R5356:Myo15a UTSW 11 60,389,192 (GRCm39) missense probably damaging 1.00
R5445:Myo15a UTSW 11 60,411,603 (GRCm39) nonsense probably null
R5477:Myo15a UTSW 11 60,368,503 (GRCm39) missense probably damaging 1.00
R5629:Myo15a UTSW 11 60,370,578 (GRCm39) missense probably benign
R5728:Myo15a UTSW 11 60,379,722 (GRCm39) missense probably damaging 1.00
R5818:Myo15a UTSW 11 60,388,777 (GRCm39) missense probably benign 0.06
R5952:Myo15a UTSW 11 60,370,246 (GRCm39) missense possibly damaging 0.50
R6338:Myo15a UTSW 11 60,368,959 (GRCm39) missense probably damaging 0.99
R6467:Myo15a UTSW 11 60,417,487 (GRCm39) critical splice donor site probably null
R6488:Myo15a UTSW 11 60,369,313 (GRCm39) missense possibly damaging 0.86
R6521:Myo15a UTSW 11 60,393,195 (GRCm39) missense probably damaging 1.00
R6645:Myo15a UTSW 11 60,368,118 (GRCm39) missense probably benign 0.00
R6702:Myo15a UTSW 11 60,383,818 (GRCm39) missense probably benign 0.16
R6703:Myo15a UTSW 11 60,383,818 (GRCm39) missense probably benign 0.16
R6821:Myo15a UTSW 11 60,415,301 (GRCm39) missense probably damaging 1.00
R6882:Myo15a UTSW 11 60,414,832 (GRCm39) missense probably damaging 1.00
R6908:Myo15a UTSW 11 60,396,832 (GRCm39) missense probably damaging 1.00
R6932:Myo15a UTSW 11 60,390,320 (GRCm39) missense probably damaging 1.00
R6958:Myo15a UTSW 11 60,394,451 (GRCm39) missense probably benign 0.07
R7041:Myo15a UTSW 11 60,396,832 (GRCm39) missense probably damaging 1.00
R7149:Myo15a UTSW 11 60,400,836 (GRCm39) missense possibly damaging 0.56
R7163:Myo15a UTSW 11 60,389,195 (GRCm39) missense
R7229:Myo15a UTSW 11 60,387,321 (GRCm39) missense probably benign 0.08
R7347:Myo15a UTSW 11 60,368,787 (GRCm39) missense probably benign
R7368:Myo15a UTSW 11 60,381,741 (GRCm39) splice site probably null
R7414:Myo15a UTSW 11 60,374,309 (GRCm39) missense
R7461:Myo15a UTSW 11 60,395,978 (GRCm39) missense
R7609:Myo15a UTSW 11 60,379,637 (GRCm39) missense
R7613:Myo15a UTSW 11 60,395,978 (GRCm39) missense
R7734:Myo15a UTSW 11 60,401,108 (GRCm39) missense probably benign
R7748:Myo15a UTSW 11 60,395,727 (GRCm39) missense
R7767:Myo15a UTSW 11 60,392,922 (GRCm39) missense
R7769:Myo15a UTSW 11 60,399,975 (GRCm39) missense
R7894:Myo15a UTSW 11 60,381,963 (GRCm39) missense
R7919:Myo15a UTSW 11 60,417,356 (GRCm39) missense probably damaging 1.00
R8100:Myo15a UTSW 11 60,408,016 (GRCm39) missense probably damaging 1.00
R8124:Myo15a UTSW 11 60,398,279 (GRCm39) missense
R8129:Myo15a UTSW 11 60,399,026 (GRCm39) missense
R8428:Myo15a UTSW 11 60,387,241 (GRCm39) missense probably damaging 1.00
R8706:Myo15a UTSW 11 60,370,443 (GRCm39) missense probably benign
R8735:Myo15a UTSW 11 60,401,679 (GRCm39) critical splice acceptor site probably null
R8739:Myo15a UTSW 11 60,368,088 (GRCm39) missense probably benign 0.06
R8790:Myo15a UTSW 11 60,378,047 (GRCm39) missense
R8790:Myo15a UTSW 11 60,367,362 (GRCm39) missense possibly damaging 0.73
R8822:Myo15a UTSW 11 60,367,740 (GRCm39) missense probably damaging 0.99
R8907:Myo15a UTSW 11 60,417,434 (GRCm39) missense
R8931:Myo15a UTSW 11 60,368,020 (GRCm39) missense probably benign
R9061:Myo15a UTSW 11 60,393,692 (GRCm39) missense
R9124:Myo15a UTSW 11 60,369,952 (GRCm39) missense probably benign 0.37
R9297:Myo15a UTSW 11 60,385,899 (GRCm39) missense probably null
R9347:Myo15a UTSW 11 60,374,555 (GRCm39) missense
R9417:Myo15a UTSW 11 60,378,243 (GRCm39) missense
R9456:Myo15a UTSW 11 60,392,668 (GRCm39) missense
R9460:Myo15a UTSW 11 60,372,566 (GRCm39) critical splice donor site probably null
R9615:Myo15a UTSW 11 60,374,320 (GRCm39) missense
R9630:Myo15a UTSW 11 60,407,988 (GRCm39) missense probably damaging 1.00
R9746:Myo15a UTSW 11 60,378,234 (GRCm39) nonsense probably null
X0021:Myo15a UTSW 11 60,373,185 (GRCm39) nonsense probably null
X0066:Myo15a UTSW 11 60,369,046 (GRCm39) missense probably damaging 1.00
X0067:Myo15a UTSW 11 60,369,444 (GRCm39) missense possibly damaging 0.88
Z1176:Myo15a UTSW 11 60,389,229 (GRCm39) missense
Z1176:Myo15a UTSW 11 60,379,084 (GRCm39) missense
Z1176:Myo15a UTSW 11 60,415,267 (GRCm39) missense probably damaging 1.00
Z1177:Myo15a UTSW 11 60,386,301 (GRCm39) missense
Z1177:Myo15a UTSW 11 60,379,663 (GRCm39) missense
Z1177:Myo15a UTSW 11 60,368,349 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTGCTAAAAGAGAAGCCCTAATC -3'
(R):5'- AGCTCTGTACATATTTAGTTCTGCC -3'

Sequencing Primer
(F):5'- TCAGGTGCCAGCTCAAGTATC -3'
(R):5'- AGTTCTGCCCATATTTATTTAGCTC -3'
Posted On 2019-09-13