Mutagenetix > Incidental Mutation

Incidental Mutation 'R7392:Slc8a3'

573533

Institutional Source

Beutler Lab

Gene Symbol

Slc8a3

Ensembl Gene

ENSMUSG00000079055

Gene Name

solute carrier family 8 (sodium/calcium exchanger), member 3

Synonyms

Ncx3

MMRRC Submission

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R7392 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

81197915-81333180 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to C at 81314803 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Glycine at position 414 (V414G)

Ref Sequence

ENSEMBL: ENSMUSP00000138735 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000064594] [ENSMUST00000085238] [ENSMUST00000182208]

AlphaFold

S4R2P9

Predicted Effect

SMART Domains

Protein: ENSMUSP00000063258
Gene: ENSMUSG00000079055
AA Change: V414G

Domain	Start	End	E-Value	Type
signal peptide	1	32	N/A	INTRINSIC
Pfam:Na_Ca_ex	79	250	1.3e-36	PFAM
Pfam:Na_Ca_ex_C	253	379	4.6e-57	PFAM
Calx_beta	385	485	3.25e-42	SMART
Calx_beta	519	619	1.04e-40	SMART
low complexity region	712	723	N/A	INTRINSIC
Pfam:Na_Ca_ex	754	919	2e-27	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000085238
AA Change: V414G

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000082334
Gene: ENSMUSG00000079055
AA Change: V414G

Domain	Start	End	E-Value	Type
signal peptide	1	32	N/A	INTRINSIC
Pfam:Na_Ca_ex	79	250	1.3e-36	PFAM
Pfam:Na_Ca_ex_C	253	379	4.6e-57	PFAM
Calx_beta	385	485	3.25e-42	SMART
Calx_beta	519	619	1.54e-43	SMART
low complexity region	705	716	N/A	INTRINSIC
Pfam:Na_Ca_ex	747	912	1.9e-27	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000182208
AA Change: V414G

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000138735
Gene: ENSMUSG00000079055
AA Change: V414G

Domain	Start	End	E-Value	Type
signal peptide	1	32	N/A	INTRINSIC
Pfam:Na_Ca_ex	89	248	8.1e-38	PFAM
Calx_beta	385	485	3.25e-42	SMART
Calx_beta	519	619	1.04e-40	SMART
low complexity region	712	723	N/A	INTRINSIC
Pfam:Na_Ca_ex	764	917	9.1e-27	PFAM

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 98.8%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the sodium/calcium exchanger integral membrane protein family. Na+/Ca2+ exchange proteins are involved in maintaining Ca2+ homeostasis in a wide variety of cell types. The protein is regulated by intracellular calcium ions and is found in both the plasma membrane and intracellular organellar membranes, where exchange of Na+ for Ca2+ occurs in an electrogenic manner. Alternative splicing has been observed for this gene and multiple variants have been described. [provided by RefSeq, Aug 2013]
PHENOTYPE: Mice homozygous for disruptions in this gene display a normal phenotype. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 83 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2610021A01Rik	T	A	7: 41,626,566	F564L	probably damaging	Het
4930539E08Rik	A	T	17: 28,908,377	D219E	probably benign	Het
9530053A07Rik	C	T	7: 28,164,372	T2523M	possibly damaging	Het
Abcc2	T	C	19: 43,808,687	I499T	probably damaging	Het
Adamts13	C	T	2: 26,989,324	R630C	probably damaging	Het
Adgrv1	A	T	13: 81,560,689	F1199I	probably damaging	Het
Agbl5	G	A	5: 30,890,771		probably null	Het
Anks1b	A	G	10: 90,680,786	D881G	possibly damaging	Het
Arap2	A	T	5: 62,698,385	S569R	possibly damaging	Het
Arhgap15	T	C	2: 44,063,774	S171P	possibly damaging	Het
Arhgef11	G	A	3: 87,717,175		probably null	Het
Baz1a	C	A	12: 54,898,765	L1271F	probably damaging	Het
Bdnf	A	C	2: 109,723,930	K216N	probably benign	Het
Bmp7	C	T	2: 172,870,205	D409N	probably damaging	Het
Cacna1c	T	A	6: 118,741,920	I390F		Het
Chd8	A	G	14: 52,232,855	S433P	probably benign	Het
Clrn2	A	G	5: 45,463,909	E215G	possibly damaging	Het
Col19a1	T	G	1: 24,534,034	D219A	unknown	Het
Col2a1	G	A	15: 97,980,151	R1036*	probably null	Het
Copg1	T	A	6: 87,890,275	V110D	probably benign	Het
Cpd	C	T	11: 76,801,779	G744D	probably damaging	Het
Crygs	G	A	16: 22,806,502	P63L	probably benign	Het
Dcn	A	G	10: 97,509,998	D224G	probably damaging	Het
Dnah7a	T	C	1: 53,501,661	E2518G	probably benign	Het
Efcab6	C	A	15: 83,988,951	R197L	probably benign	Het
Efr3b	T	A	12: 3,969,588	Y723F	probably benign	Het
Enam	A	G	5: 88,501,664	N344S	probably damaging	Het
Erich4	A	G	7: 25,615,676	I58T	possibly damaging	Het
Esrp1	A	G	4: 11,338,809	V665A	probably benign	Het
Etf1	G	A	18: 34,906,050	T388I	probably benign	Het
Faf1	A	G	4: 109,794,843	T244A	probably benign	Het
Fam129a	A	G	1: 151,696,224	T307A	probably damaging	Het
Fbn1	T	C	2: 125,343,924	D1610G	probably damaging	Het
Frem1	G	T	4: 83,013,827	F212L	probably benign	Het
Fuom	T	A	7: 140,101,160	D85V	probably damaging	Het
Gcfc2	T	C	6: 81,943,012		probably null	Het
Gpr37	C	T	6: 25,688,787	A104T	probably benign	Het
Hsp90ab1	G	C	17: 45,569,048	T514S	probably benign	Het
Ifnl2	A	G	7: 28,509,669	F74L	probably benign	Het
Ipo11	G	A	13: 106,891,691	R367*	probably null	Het
Itpr2	T	C	6: 146,359,340	D963G	possibly damaging	Het
Krt15	A	T	11: 100,135,560	V100E	possibly damaging	Het
Lrch3	T	A	16: 32,986,755	L466*	probably null	Het
Lrfn5	A	T	12: 61,840,304	T293S	probably benign	Het
Lrp5	A	G	19: 3,610,199	I955T	probably damaging	Het
Lrrc4b	C	T	7: 44,462,015	T437M	probably damaging	Het
Man1a	A	G	10: 53,919,187	Y657H	probably damaging	Het
Mapkap1	G	T	2: 34,435,154	R94L	probably damaging	Het
Mtmr4	T	A	11: 87,604,557	L480Q	probably damaging	Het
Mycbp2	T	C	14: 103,152,191	I3504M	probably damaging	Het
Mycbp2	A	T	14: 103,243,128	C1169S	probably damaging	Het
Myo15	T	C	11: 60,505,976	S1455P		Het
Nid2	A	G	14: 19,768,656	D406G	probably benign	Het
Nrip2	A	G	6: 128,404,950	I69V	probably benign	Het
Nthl1	G	A	17: 24,638,624	V266I	probably benign	Het
Olfr1000	A	C	2: 85,608,488	C141G	possibly damaging	Het
Olfr1061	A	G	2: 86,413,152	V300A	probably benign	Het
Olfr1440	G	T	19: 12,394,465	L67F	probably damaging	Het
Olfr1444	A	G	19: 12,862,587	T271A	probably benign	Het
Olfr284	A	G	15: 98,340,311	V226A	probably benign	Het
Olfr501-ps1	C	A	7: 108,508,084	H9Q	possibly damaging	Het
Olfr698	T	C	7: 106,753,382	E2G	possibly damaging	Het
Pcdhb1	A	C	18: 37,265,118	S41R	possibly damaging	Het
Pdcd11	T	A	19: 47,127,997	F1529I	probably damaging	Het
Plcd3	C	A	11: 103,101,557		probably benign	Het
Qdpr	T	C	5: 45,439,376	M149V	probably benign	Het
R3hcc1	T	A	14: 69,705,880		probably null	Het
Rasgrf2	T	C	13: 91,893,737	Y392C		Het
Slco1a6	A	G	6: 142,157,277	S54P	probably benign	Het
Sos1	C	A	17: 80,424,200	V624F	probably damaging	Het
Spdef	T	C	17: 27,717,288	D227G	probably benign	Het
Sptb	G	T	12: 76,624,229	Q447K	probably damaging	Het
Srsf12	A	T	4: 33,209,265	R62W	unknown	Het
Stag3	T	C	5: 138,291,366	L266P	probably damaging	Het
Sult2b1	T	C	7: 45,742,438		probably benign	Het
Taf1a	A	G	1: 183,409,276	T66A		Het
Tfg	A	T	16: 56,712,609		probably null	Het
Trim34b	A	G	7: 104,336,397	N413S	probably benign	Het
Txndc15	T	A	13: 55,721,586	M184K	probably damaging	Het
Umodl1	A	C	17: 30,982,332	S412R	probably damaging	Het
Zbtb8b	T	A	4: 129,432,890	M161L	probably benign	Het
Zfp597	A	T	16: 3,866,505	V129E	probably benign	Het
Zfp790	T	C	7: 29,828,625	I245T	possibly damaging	Het

Other mutations in Slc8a3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00164:Slc8a3	APN	12	81314569	missense	probably benign
IGL01315:Slc8a3	APN	12	81314395	missense	probably damaging	0.97
IGL01365:Slc8a3	APN	12	81315376	missense	probably damaging	0.99
IGL01610:Slc8a3	APN	12	81315802	missense	probably damaging	1.00
IGL02227:Slc8a3	APN	12	81315683	missense	probably damaging	1.00
IGL02299:Slc8a3	APN	12	81315224	missense	probably damaging	0.98
IGL02548:Slc8a3	APN	12	81204156	splice site	probably benign
IGL02646:Slc8a3	APN	12	81315094	missense	probably damaging	1.00
IGL03135:Slc8a3	APN	12	81202249	missense	probably damaging	1.00
R0050:Slc8a3	UTSW	12	81315265	missense	probably damaging	1.00
R0627:Slc8a3	UTSW	12	81314842	missense	probably damaging	1.00
R0648:Slc8a3	UTSW	12	81314446	missense	probably damaging	1.00
R1342:Slc8a3	UTSW	12	81316016	missense	probably damaging	0.99
R1437:Slc8a3	UTSW	12	81315986	missense	probably damaging	0.99
R1470:Slc8a3	UTSW	12	81199710	missense	probably benign
R1470:Slc8a3	UTSW	12	81199710	missense	probably benign
R1557:Slc8a3	UTSW	12	81315557	missense	probably damaging	1.00
R1563:Slc8a3	UTSW	12	81205007	missense	possibly damaging	0.47
R1918:Slc8a3	UTSW	12	81314844	missense	probably damaging	0.99
R1930:Slc8a3	UTSW	12	81314446	missense	probably damaging	1.00
R1931:Slc8a3	UTSW	12	81314446	missense	probably damaging	1.00
R2232:Slc8a3	UTSW	12	81315220	missense	probably damaging	0.99
R2680:Slc8a3	UTSW	12	81202339	missense	probably damaging	0.99
R2941:Slc8a3	UTSW	12	81315179	missense	probably damaging	1.00
R3157:Slc8a3	UTSW	12	81314992	missense	probably damaging	1.00
R3159:Slc8a3	UTSW	12	81314992	missense	probably damaging	1.00
R3751:Slc8a3	UTSW	12	81204138	missense	probably damaging	1.00
R3859:Slc8a3	UTSW	12	81314872	missense	probably damaging	0.99
R4240:Slc8a3	UTSW	12	81315176	missense	probably damaging	0.99
R4527:Slc8a3	UTSW	12	81315853	missense	probably damaging	1.00
R4547:Slc8a3	UTSW	12	81314851	missense	possibly damaging	0.76
R4951:Slc8a3	UTSW	12	81314699	missense	probably benign	0.31
R4951:Slc8a3	UTSW	12	81315986	missense	probably damaging	0.99
R5022:Slc8a3	UTSW	12	81199558	missense	probably damaging	0.96
R5049:Slc8a3	UTSW	12	81214132	missense	probably damaging	1.00
R5057:Slc8a3	UTSW	12	81199558	missense	probably damaging	0.96
R5104:Slc8a3	UTSW	12	81214134	missense	probably null	0.34
R5122:Slc8a3	UTSW	12	81314258	critical splice donor site	probably null
R5183:Slc8a3	UTSW	12	81314491	missense	possibly damaging	0.79
R5629:Slc8a3	UTSW	12	81199631	missense	probably damaging	1.00
R6062:Slc8a3	UTSW	12	81314350	missense	probably damaging	1.00
R6218:Slc8a3	UTSW	12	81199567	missense	probably benign
R6279:Slc8a3	UTSW	12	81314978	missense	probably damaging	0.99
R6300:Slc8a3	UTSW	12	81314978	missense	probably damaging	0.99
R6416:Slc8a3	UTSW	12	81315627	missense	probably damaging	1.00
R6790:Slc8a3	UTSW	12	81314432	missense	probably benign	0.00
R6999:Slc8a3	UTSW	12	81314755	missense	probably benign	0.06
R7195:Slc8a3	UTSW	12	81314273	missense	possibly damaging	0.95
R7268:Slc8a3	UTSW	12	81315053	missense	probably damaging	0.98
R7288:Slc8a3	UTSW	12	81216824	missense	possibly damaging	0.70
R7383:Slc8a3	UTSW	12	81315805	missense	probably damaging	1.00
R7394:Slc8a3	UTSW	12	81214058	splice site	probably null
R7549:Slc8a3	UTSW	12	81314770	missense	probably benign	0.06
R7657:Slc8a3	UTSW	12	81314384	missense	probably damaging	1.00
R7699:Slc8a3	UTSW	12	81314473	missense	probably damaging	1.00
R7759:Slc8a3	UTSW	12	81314551	missense	probably benign
R7960:Slc8a3	UTSW	12	81216732	missense	probably benign	0.00
R7985:Slc8a3	UTSW	12	81314993	missense	probably damaging	1.00
R8059:Slc8a3	UTSW	12	81202258	missense	probably damaging	1.00
R8192:Slc8a3	UTSW	12	81199681	missense	probably damaging	1.00
R8397:Slc8a3	UTSW	12	81199768	missense	probably benign	0.45
R8413:Slc8a3	UTSW	12	81314678	missense	probably damaging	0.97
R8681:Slc8a3	UTSW	12	81315140	missense	probably benign
R9060:Slc8a3	UTSW	12	81214078	missense	probably benign	0.45
R9061:Slc8a3	UTSW	12	81216766	missense	probably damaging	0.99
R9267:Slc8a3	UTSW	12	81314434	missense	possibly damaging	0.77
R9416:Slc8a3	UTSW	12	81315064	missense	probably benign	0.06
R9519:Slc8a3	UTSW	12	81315552	missense	probably benign	0.30
R9531:Slc8a3	UTSW	12	81315223	missense	probably damaging	1.00
X0026:Slc8a3	UTSW	12	81315287	missense	probably benign	0.22
X0028:Slc8a3	UTSW	12	81314943	missense	probably damaging	1.00
Z1177:Slc8a3	UTSW	12	81314700	missense	possibly damaging	0.92
Z1177:Slc8a3	UTSW	12	81315876	missense	probably benign	0.13

Predicted Primers

PCR Primer
(F):5'- CTCAGCCTCACAAAGAAGTGTTC -3'
(R):5'- GTGCTTTCTACCGCATCCAAG -3'

Sequencing Primer
(F):5'- AGTGTTCATCCTCCTCAAAAATGTC -3'
(R):5'- AAGCCACCCGGATGATGACTG -3'

Posted On

2019-09-13