Incidental Mutation 'R7392:Slc8a3'
ID 573533
Institutional Source Beutler Lab
Gene Symbol Slc8a3
Ensembl Gene ENSMUSG00000079055
Gene Name solute carrier family 8 (sodium/calcium exchanger), member 3
Synonyms Ncx3
MMRRC Submission 045474-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R7392 (G1)
Quality Score 225.009
Status Not validated
Chromosome 12
Chromosomal Location 81244689-81379954 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to C at 81361577 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Glycine at position 414 (V414G)
Ref Sequence ENSEMBL: ENSMUSP00000138735 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000064594] [ENSMUST00000085238] [ENSMUST00000182208]
AlphaFold S4R2P9
Predicted Effect
SMART Domains Protein: ENSMUSP00000063258
Gene: ENSMUSG00000079055
AA Change: V414G

DomainStartEndE-ValueType
signal peptide 1 32 N/A INTRINSIC
Pfam:Na_Ca_ex 79 250 1.3e-36 PFAM
Pfam:Na_Ca_ex_C 253 379 4.6e-57 PFAM
Calx_beta 385 485 3.25e-42 SMART
Calx_beta 519 619 1.04e-40 SMART
low complexity region 712 723 N/A INTRINSIC
Pfam:Na_Ca_ex 754 919 2e-27 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000085238
AA Change: V414G

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000082334
Gene: ENSMUSG00000079055
AA Change: V414G

DomainStartEndE-ValueType
signal peptide 1 32 N/A INTRINSIC
Pfam:Na_Ca_ex 79 250 1.3e-36 PFAM
Pfam:Na_Ca_ex_C 253 379 4.6e-57 PFAM
Calx_beta 385 485 3.25e-42 SMART
Calx_beta 519 619 1.54e-43 SMART
low complexity region 705 716 N/A INTRINSIC
Pfam:Na_Ca_ex 747 912 1.9e-27 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000182208
AA Change: V414G

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000138735
Gene: ENSMUSG00000079055
AA Change: V414G

DomainStartEndE-ValueType
signal peptide 1 32 N/A INTRINSIC
Pfam:Na_Ca_ex 89 248 8.1e-38 PFAM
Calx_beta 385 485 3.25e-42 SMART
Calx_beta 519 619 1.04e-40 SMART
low complexity region 712 723 N/A INTRINSIC
Pfam:Na_Ca_ex 764 917 9.1e-27 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the sodium/calcium exchanger integral membrane protein family. Na+/Ca2+ exchange proteins are involved in maintaining Ca2+ homeostasis in a wide variety of cell types. The protein is regulated by intracellular calcium ions and is found in both the plasma membrane and intracellular organellar membranes, where exchange of Na+ for Ca2+ occurs in an electrogenic manner. Alternative splicing has been observed for this gene and multiple variants have been described. [provided by RefSeq, Aug 2013]
PHENOTYPE: Mice homozygous for disruptions in this gene display a normal phenotype. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 83 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610021A01Rik T A 7: 41,275,990 (GRCm39) F564L probably damaging Het
Abcc2 T C 19: 43,797,126 (GRCm39) I499T probably damaging Het
Adamts13 C T 2: 26,879,336 (GRCm39) R630C probably damaging Het
Adgrv1 A T 13: 81,708,808 (GRCm39) F1199I probably damaging Het
Agbl5 G A 5: 31,048,115 (GRCm39) probably null Het
Anks1b A G 10: 90,516,648 (GRCm39) D881G possibly damaging Het
Arap2 A T 5: 62,855,728 (GRCm39) S569R possibly damaging Het
Arhgap15 T C 2: 43,953,786 (GRCm39) S171P possibly damaging Het
Arhgef11 G A 3: 87,624,482 (GRCm39) probably null Het
Baz1a C A 12: 54,945,550 (GRCm39) L1271F probably damaging Het
Bdnf A C 2: 109,554,275 (GRCm39) K216N probably benign Het
Bmp7 C T 2: 172,711,998 (GRCm39) D409N probably damaging Het
Bnip5 A T 17: 29,127,351 (GRCm39) D219E probably benign Het
Cacna1c T A 6: 118,718,881 (GRCm39) I390F Het
Chd8 A G 14: 52,470,312 (GRCm39) S433P probably benign Het
Clrn2 A G 5: 45,621,251 (GRCm39) E215G possibly damaging Het
Col19a1 T G 1: 24,573,115 (GRCm39) D219A unknown Het
Col2a1 G A 15: 97,878,032 (GRCm39) R1036* probably null Het
Copg1 T A 6: 87,867,257 (GRCm39) V110D probably benign Het
Cpd C T 11: 76,692,605 (GRCm39) G744D probably damaging Het
Crygs G A 16: 22,625,252 (GRCm39) P63L probably benign Het
Dcn A G 10: 97,345,860 (GRCm39) D224G probably damaging Het
Dnah7a T C 1: 53,540,820 (GRCm39) E2518G probably benign Het
Efcab6 C A 15: 83,873,152 (GRCm39) R197L probably benign Het
Efr3b T A 12: 4,019,588 (GRCm39) Y723F probably benign Het
Enam A G 5: 88,649,523 (GRCm39) N344S probably damaging Het
Erich4 A G 7: 25,315,101 (GRCm39) I58T possibly damaging Het
Esrp1 A G 4: 11,338,809 (GRCm39) V665A probably benign Het
Etf1 G A 18: 35,039,103 (GRCm39) T388I probably benign Het
Faf1 A G 4: 109,652,040 (GRCm39) T244A probably benign Het
Fbn1 T C 2: 125,185,844 (GRCm39) D1610G probably damaging Het
Fcgbpl1 C T 7: 27,863,797 (GRCm39) T2523M possibly damaging Het
Frem1 G T 4: 82,932,064 (GRCm39) F212L probably benign Het
Fuom T A 7: 139,681,073 (GRCm39) D85V probably damaging Het
Gcfc2 T C 6: 81,919,993 (GRCm39) probably null Het
Gpr37 C T 6: 25,688,786 (GRCm39) A104T probably benign Het
Hsp90ab1 G C 17: 45,879,974 (GRCm39) T514S probably benign Het
Ifnl2 A G 7: 28,209,094 (GRCm39) F74L probably benign Het
Ipo11 G A 13: 107,028,199 (GRCm39) R367* probably null Het
Itpr2 T C 6: 146,260,838 (GRCm39) D963G possibly damaging Het
Krt15 A T 11: 100,026,386 (GRCm39) V100E possibly damaging Het
Lrch3 T A 16: 32,807,125 (GRCm39) L466* probably null Het
Lrfn5 A T 12: 61,887,090 (GRCm39) T293S probably benign Het
Lrp5 A G 19: 3,660,199 (GRCm39) I955T probably damaging Het
Lrrc4b C T 7: 44,111,439 (GRCm39) T437M probably damaging Het
Man1a A G 10: 53,795,283 (GRCm39) Y657H probably damaging Het
Mapkap1 G T 2: 34,325,166 (GRCm39) R94L probably damaging Het
Mtmr4 T A 11: 87,495,383 (GRCm39) L480Q probably damaging Het
Mycbp2 T C 14: 103,389,627 (GRCm39) I3504M probably damaging Het
Mycbp2 A T 14: 103,480,564 (GRCm39) C1169S probably damaging Het
Myo15a T C 11: 60,396,802 (GRCm39) S1455P Het
Niban1 A G 1: 151,571,975 (GRCm39) T307A probably damaging Het
Nid2 A G 14: 19,818,724 (GRCm39) D406G probably benign Het
Nrip2 A G 6: 128,381,913 (GRCm39) I69V probably benign Het
Nthl1 G A 17: 24,857,598 (GRCm39) V266I probably benign Het
Or2ag16 T C 7: 106,352,589 (GRCm39) E2G possibly damaging Het
Or5an6 G T 19: 12,371,829 (GRCm39) L67F probably damaging Het
Or5b21 A G 19: 12,839,951 (GRCm39) T271A probably benign Het
Or5g23 A C 2: 85,438,832 (GRCm39) C141G possibly damaging Het
Or5p75-ps1 C A 7: 108,107,291 (GRCm39) H9Q possibly damaging Het
Or8k25 A G 2: 86,243,496 (GRCm39) V300A probably benign Het
Or8s5 A G 15: 98,238,192 (GRCm39) V226A probably benign Het
Pcdhb1 A C 18: 37,398,171 (GRCm39) S41R possibly damaging Het
Pdcd11 T A 19: 47,116,436 (GRCm39) F1529I probably damaging Het
Plcd3 C A 11: 102,992,383 (GRCm39) probably benign Het
Qdpr T C 5: 45,596,718 (GRCm39) M149V probably benign Het
R3hcc1 T A 14: 69,943,329 (GRCm39) probably null Het
Rasgrf2 T C 13: 92,041,856 (GRCm39) Y392C Het
Slco1a6 A G 6: 142,103,003 (GRCm39) S54P probably benign Het
Sos1 C A 17: 80,731,629 (GRCm39) V624F probably damaging Het
Spdef T C 17: 27,936,262 (GRCm39) D227G probably benign Het
Sptb G T 12: 76,671,003 (GRCm39) Q447K probably damaging Het
Srsf12 A T 4: 33,209,265 (GRCm39) R62W unknown Het
Stag3 T C 5: 138,289,628 (GRCm39) L266P probably damaging Het
Sult2b1 T C 7: 45,391,862 (GRCm39) probably benign Het
Taf1a A G 1: 183,190,095 (GRCm39) T66A Het
Tfg A T 16: 56,532,972 (GRCm39) probably null Het
Trim34b A G 7: 103,985,604 (GRCm39) N413S probably benign Het
Txndc15 T A 13: 55,869,399 (GRCm39) M184K probably damaging Het
Umodl1 A C 17: 31,201,306 (GRCm39) S412R probably damaging Het
Zbtb8b T A 4: 129,326,683 (GRCm39) M161L probably benign Het
Zfp597 A T 16: 3,684,369 (GRCm39) V129E probably benign Het
Zfp790 T C 7: 29,528,050 (GRCm39) I245T possibly damaging Het
Other mutations in Slc8a3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00164:Slc8a3 APN 12 81,361,343 (GRCm39) missense probably benign
IGL01315:Slc8a3 APN 12 81,361,169 (GRCm39) missense probably damaging 0.97
IGL01365:Slc8a3 APN 12 81,362,150 (GRCm39) missense probably damaging 0.99
IGL01610:Slc8a3 APN 12 81,362,576 (GRCm39) missense probably damaging 1.00
IGL02227:Slc8a3 APN 12 81,362,457 (GRCm39) missense probably damaging 1.00
IGL02299:Slc8a3 APN 12 81,361,998 (GRCm39) missense probably damaging 0.98
IGL02548:Slc8a3 APN 12 81,250,930 (GRCm39) splice site probably benign
IGL02646:Slc8a3 APN 12 81,361,868 (GRCm39) missense probably damaging 1.00
IGL03135:Slc8a3 APN 12 81,249,023 (GRCm39) missense probably damaging 1.00
R0050:Slc8a3 UTSW 12 81,362,039 (GRCm39) missense probably damaging 1.00
R0627:Slc8a3 UTSW 12 81,361,616 (GRCm39) missense probably damaging 1.00
R0648:Slc8a3 UTSW 12 81,361,220 (GRCm39) missense probably damaging 1.00
R1342:Slc8a3 UTSW 12 81,362,790 (GRCm39) missense probably damaging 0.99
R1437:Slc8a3 UTSW 12 81,362,760 (GRCm39) missense probably damaging 0.99
R1470:Slc8a3 UTSW 12 81,246,484 (GRCm39) missense probably benign
R1470:Slc8a3 UTSW 12 81,246,484 (GRCm39) missense probably benign
R1557:Slc8a3 UTSW 12 81,362,331 (GRCm39) missense probably damaging 1.00
R1563:Slc8a3 UTSW 12 81,251,781 (GRCm39) missense possibly damaging 0.47
R1918:Slc8a3 UTSW 12 81,361,618 (GRCm39) missense probably damaging 0.99
R1930:Slc8a3 UTSW 12 81,361,220 (GRCm39) missense probably damaging 1.00
R1931:Slc8a3 UTSW 12 81,361,220 (GRCm39) missense probably damaging 1.00
R2232:Slc8a3 UTSW 12 81,361,994 (GRCm39) missense probably damaging 0.99
R2680:Slc8a3 UTSW 12 81,249,113 (GRCm39) missense probably damaging 0.99
R2941:Slc8a3 UTSW 12 81,361,953 (GRCm39) missense probably damaging 1.00
R3157:Slc8a3 UTSW 12 81,361,766 (GRCm39) missense probably damaging 1.00
R3159:Slc8a3 UTSW 12 81,361,766 (GRCm39) missense probably damaging 1.00
R3751:Slc8a3 UTSW 12 81,250,912 (GRCm39) missense probably damaging 1.00
R3859:Slc8a3 UTSW 12 81,361,646 (GRCm39) missense probably damaging 0.99
R4240:Slc8a3 UTSW 12 81,361,950 (GRCm39) missense probably damaging 0.99
R4527:Slc8a3 UTSW 12 81,362,627 (GRCm39) missense probably damaging 1.00
R4547:Slc8a3 UTSW 12 81,361,625 (GRCm39) missense possibly damaging 0.76
R4951:Slc8a3 UTSW 12 81,362,760 (GRCm39) missense probably damaging 0.99
R4951:Slc8a3 UTSW 12 81,361,473 (GRCm39) missense probably benign 0.31
R5022:Slc8a3 UTSW 12 81,246,332 (GRCm39) missense probably damaging 0.96
R5049:Slc8a3 UTSW 12 81,260,906 (GRCm39) missense probably damaging 1.00
R5057:Slc8a3 UTSW 12 81,246,332 (GRCm39) missense probably damaging 0.96
R5104:Slc8a3 UTSW 12 81,260,908 (GRCm39) missense probably null 0.34
R5122:Slc8a3 UTSW 12 81,361,032 (GRCm39) critical splice donor site probably null
R5183:Slc8a3 UTSW 12 81,361,265 (GRCm39) missense possibly damaging 0.79
R5629:Slc8a3 UTSW 12 81,246,405 (GRCm39) missense probably damaging 1.00
R6062:Slc8a3 UTSW 12 81,361,124 (GRCm39) missense probably damaging 1.00
R6218:Slc8a3 UTSW 12 81,246,341 (GRCm39) missense probably benign
R6279:Slc8a3 UTSW 12 81,361,752 (GRCm39) missense probably damaging 0.99
R6300:Slc8a3 UTSW 12 81,361,752 (GRCm39) missense probably damaging 0.99
R6416:Slc8a3 UTSW 12 81,362,401 (GRCm39) missense probably damaging 1.00
R6790:Slc8a3 UTSW 12 81,361,206 (GRCm39) missense probably benign 0.00
R6999:Slc8a3 UTSW 12 81,361,529 (GRCm39) missense probably benign 0.06
R7195:Slc8a3 UTSW 12 81,361,047 (GRCm39) missense possibly damaging 0.95
R7268:Slc8a3 UTSW 12 81,361,827 (GRCm39) missense probably damaging 0.98
R7288:Slc8a3 UTSW 12 81,263,598 (GRCm39) missense possibly damaging 0.70
R7383:Slc8a3 UTSW 12 81,362,579 (GRCm39) missense probably damaging 1.00
R7394:Slc8a3 UTSW 12 81,260,832 (GRCm39) splice site probably null
R7549:Slc8a3 UTSW 12 81,361,544 (GRCm39) missense probably benign 0.06
R7657:Slc8a3 UTSW 12 81,361,158 (GRCm39) missense probably damaging 1.00
R7699:Slc8a3 UTSW 12 81,361,247 (GRCm39) missense probably damaging 1.00
R7759:Slc8a3 UTSW 12 81,361,325 (GRCm39) missense probably benign
R7960:Slc8a3 UTSW 12 81,263,506 (GRCm39) missense probably benign 0.00
R7985:Slc8a3 UTSW 12 81,361,767 (GRCm39) missense probably damaging 1.00
R8059:Slc8a3 UTSW 12 81,249,032 (GRCm39) missense probably damaging 1.00
R8192:Slc8a3 UTSW 12 81,246,455 (GRCm39) missense probably damaging 1.00
R8397:Slc8a3 UTSW 12 81,246,542 (GRCm39) missense probably benign 0.45
R8413:Slc8a3 UTSW 12 81,361,452 (GRCm39) missense probably damaging 0.97
R8681:Slc8a3 UTSW 12 81,361,914 (GRCm39) missense probably benign
R9060:Slc8a3 UTSW 12 81,260,852 (GRCm39) missense probably benign 0.45
R9061:Slc8a3 UTSW 12 81,263,540 (GRCm39) missense probably damaging 0.99
R9267:Slc8a3 UTSW 12 81,361,208 (GRCm39) missense possibly damaging 0.77
R9416:Slc8a3 UTSW 12 81,361,838 (GRCm39) missense probably benign 0.06
R9519:Slc8a3 UTSW 12 81,362,326 (GRCm39) missense probably benign 0.30
R9531:Slc8a3 UTSW 12 81,361,997 (GRCm39) missense probably damaging 1.00
X0026:Slc8a3 UTSW 12 81,362,061 (GRCm39) missense probably benign 0.22
X0028:Slc8a3 UTSW 12 81,361,717 (GRCm39) missense probably damaging 1.00
Z1177:Slc8a3 UTSW 12 81,362,650 (GRCm39) missense probably benign 0.13
Z1177:Slc8a3 UTSW 12 81,361,474 (GRCm39) missense possibly damaging 0.92
Predicted Primers PCR Primer
(F):5'- CTCAGCCTCACAAAGAAGTGTTC -3'
(R):5'- GTGCTTTCTACCGCATCCAAG -3'

Sequencing Primer
(F):5'- AGTGTTCATCCTCCTCAAAAATGTC -3'
(R):5'- AAGCCACCCGGATGATGACTG -3'
Posted On 2019-09-13