Incidental Mutation 'R7392:Chd8'
ID573539
Institutional Source Beutler Lab
Gene Symbol Chd8
Ensembl Gene ENSMUSG00000053754
Gene Namechromodomain helicase DNA binding protein 8
SynonymsDuplin, 5830451P18Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7392 (G1)
Quality Score225.009
Status Not validated
Chromosome14
Chromosomal Location52198151-52257780 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 52232855 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 433 (S433P)
Ref Sequence ENSEMBL: ENSMUSP00000087184 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000089752] [ENSMUST00000200169] [ENSMUST00000226307]
Predicted Effect probably benign
Transcript: ENSMUST00000089752
AA Change: S433P

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000087184
Gene: ENSMUSG00000053754
AA Change: S433P

DomainStartEndE-ValueType
low complexity region 255 272 N/A INTRINSIC
low complexity region 340 374 N/A INTRINSIC
low complexity region 404 437 N/A INTRINSIC
low complexity region 463 477 N/A INTRINSIC
low complexity region 497 534 N/A INTRINSIC
low complexity region 588 607 N/A INTRINSIC
CHROMO 642 708 1.8e-9 SMART
CHROMO 724 782 1.55e-4 SMART
DEXDc 809 1011 4.13e-37 SMART
HELICc 1165 1249 1.01e-22 SMART
low complexity region 1335 1345 N/A INTRINSIC
low complexity region 1422 1441 N/A INTRINSIC
Blast:DEXDc 1460 1505 4e-16 BLAST
low complexity region 1579 1590 N/A INTRINSIC
low complexity region 1703 1714 N/A INTRINSIC
low complexity region 1770 1785 N/A INTRINSIC
low complexity region 1887 1903 N/A INTRINSIC
low complexity region 2063 2107 N/A INTRINSIC
low complexity region 2222 2239 N/A INTRINSIC
BRK 2312 2356 1.34e-19 SMART
BRK 2381 2421 1.94e-2 SMART
low complexity region 2452 2472 N/A INTRINSIC
low complexity region 2494 2510 N/A INTRINSIC
low complexity region 2514 2529 N/A INTRINSIC
low complexity region 2538 2550 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000200169
AA Change: S433P

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000142890
Gene: ENSMUSG00000053754
AA Change: S433P

DomainStartEndE-ValueType
low complexity region 255 272 N/A INTRINSIC
low complexity region 340 374 N/A INTRINSIC
low complexity region 404 437 N/A INTRINSIC
low complexity region 463 477 N/A INTRINSIC
low complexity region 497 534 N/A INTRINSIC
low complexity region 588 607 N/A INTRINSIC
CHROMO 642 708 1.8e-9 SMART
CHROMO 724 782 1.55e-4 SMART
DEXDc 809 1011 4.13e-37 SMART
HELICc 1165 1249 1.01e-22 SMART
low complexity region 1335 1345 N/A INTRINSIC
low complexity region 1422 1441 N/A INTRINSIC
Blast:DEXDc 1460 1505 4e-16 BLAST
low complexity region 1579 1590 N/A INTRINSIC
low complexity region 1703 1714 N/A INTRINSIC
low complexity region 1770 1785 N/A INTRINSIC
low complexity region 1887 1903 N/A INTRINSIC
low complexity region 2063 2107 N/A INTRINSIC
low complexity region 2222 2239 N/A INTRINSIC
BRK 2312 2356 1.34e-19 SMART
BRK 2381 2421 1.94e-2 SMART
low complexity region 2452 2472 N/A INTRINSIC
low complexity region 2494 2510 N/A INTRINSIC
low complexity region 2514 2529 N/A INTRINSIC
low complexity region 2538 2550 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000226307
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.8%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of the chromodomain-helicase-DNA binding protein family, which is characterized by a SNF2-like domain and two chromatin organization modifier domains. The encoded protein also contains brahma and kismet domains, which is common to the subfamily of chromodomain-helicase-DNA binding proteins to which this protein belongs. In mammals, this gene has been shown to function in several processes including transcriptional regulation, epigenetic remodeling, promotion of cell proliferation, and regulation of RNA synthesis. Knockout of this gene causes early embryonic lethality due to widespread apoptosis. Heterozygous loss of function mutations result in autism spectrum disorder-like behaviors that include increased anxiety, repetitive behavior, and altered social behavior. [provided by RefSeq, Dec 2016]
PHENOTYPE: Homozygous null embryos are growth retarded starting at E5.5 and exhibit developmental arrest at E6.5. Mutants develop into an egg cylinder but do not form a primitive streak or mesoderm and exhibit increased apoptosis at E7.5. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 83 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610021A01Rik T A 7: 41,626,566 F564L probably damaging Het
4930539E08Rik A T 17: 28,908,377 D219E probably benign Het
9530053A07Rik C T 7: 28,164,372 T2523M possibly damaging Het
Abcc2 T C 19: 43,808,687 I499T probably damaging Het
Adamts13 C T 2: 26,989,324 R630C probably damaging Het
Adgrv1 A T 13: 81,560,689 F1199I probably damaging Het
Agbl5 G A 5: 30,890,771 probably null Het
Anks1b A G 10: 90,680,786 D881G possibly damaging Het
Arap2 A T 5: 62,698,385 S569R possibly damaging Het
Arhgap15 T C 2: 44,063,774 S171P possibly damaging Het
Arhgef11 G A 3: 87,717,175 probably null Het
Baz1a C A 12: 54,898,765 L1271F probably damaging Het
Bdnf A C 2: 109,723,930 K216N probably benign Het
Bmp7 C T 2: 172,870,205 D409N probably damaging Het
Cacna1c T A 6: 118,741,920 I390F Het
Clrn2 A G 5: 45,463,909 E215G possibly damaging Het
Col19a1 T G 1: 24,534,034 D219A unknown Het
Col2a1 G A 15: 97,980,151 R1036* probably null Het
Copg1 T A 6: 87,890,275 V110D probably benign Het
Cpd C T 11: 76,801,779 G744D probably damaging Het
Crygs G A 16: 22,806,502 P63L probably benign Het
Dcn A G 10: 97,509,998 D224G probably damaging Het
Dnah7a T C 1: 53,501,661 E2518G probably benign Het
Efcab6 C A 15: 83,988,951 R197L probably benign Het
Efr3b T A 12: 3,969,588 Y723F probably benign Het
Enam A G 5: 88,501,664 N344S probably damaging Het
Erich4 A G 7: 25,615,676 I58T possibly damaging Het
Esrp1 A G 4: 11,338,809 V665A probably benign Het
Etf1 G A 18: 34,906,050 T388I probably benign Het
Faf1 A G 4: 109,794,843 T244A probably benign Het
Fam129a A G 1: 151,696,224 T307A probably damaging Het
Fbn1 T C 2: 125,343,924 D1610G probably damaging Het
Frem1 G T 4: 83,013,827 F212L probably benign Het
Fuom T A 7: 140,101,160 D85V probably damaging Het
Gcfc2 T C 6: 81,943,012 probably null Het
Gpr37 C T 6: 25,688,787 A104T probably benign Het
Hsp90ab1 G C 17: 45,569,048 T514S probably benign Het
Ifnl2 A G 7: 28,509,669 F74L probably benign Het
Ipo11 G A 13: 106,891,691 R367* probably null Het
Itpr2 T C 6: 146,359,340 D963G possibly damaging Het
Krt15 A T 11: 100,135,560 V100E possibly damaging Het
Lrch3 T A 16: 32,986,755 L466* probably null Het
Lrfn5 A T 12: 61,840,304 T293S probably benign Het
Lrp5 A G 19: 3,610,199 I955T probably damaging Het
Lrrc4b C T 7: 44,462,015 T437M probably damaging Het
Man1a A G 10: 53,919,187 Y657H probably damaging Het
Mapkap1 G T 2: 34,435,154 R94L probably damaging Het
Mtmr4 T A 11: 87,604,557 L480Q probably damaging Het
Mycbp2 T C 14: 103,152,191 I3504M probably damaging Het
Mycbp2 A T 14: 103,243,128 C1169S probably damaging Het
Myo15 T C 11: 60,505,976 S1455P Het
Nid2 A G 14: 19,768,656 D406G probably benign Het
Nrip2 A G 6: 128,404,950 I69V probably benign Het
Nthl1 G A 17: 24,638,624 V266I probably benign Het
Olfr1000 A C 2: 85,608,488 C141G possibly damaging Het
Olfr1061 A G 2: 86,413,152 V300A probably benign Het
Olfr1440 G T 19: 12,394,465 L67F probably damaging Het
Olfr1444 A G 19: 12,862,587 T271A probably benign Het
Olfr284 A G 15: 98,340,311 V226A probably benign Het
Olfr501-ps1 C A 7: 108,508,084 H9Q possibly damaging Het
Olfr698 T C 7: 106,753,382 E2G possibly damaging Het
Pcdhb1 A C 18: 37,265,118 S41R possibly damaging Het
Pdcd11 T A 19: 47,127,997 F1529I probably damaging Het
Plcd3 C A 11: 103,101,557 probably benign Het
Qdpr T C 5: 45,439,376 M149V probably benign Het
R3hcc1 T A 14: 69,705,880 probably null Het
Rasgrf2 T C 13: 91,893,737 Y392C Het
Slc8a3 A C 12: 81,314,803 V414G probably damaging Het
Slco1a6 A G 6: 142,157,277 S54P probably benign Het
Sos1 C A 17: 80,424,200 V624F probably damaging Het
Spdef T C 17: 27,717,288 D227G probably benign Het
Sptb G T 12: 76,624,229 Q447K probably damaging Het
Srsf12 A T 4: 33,209,265 R62W unknown Het
Stag3 T C 5: 138,291,366 L266P probably damaging Het
Sult2b1 T C 7: 45,742,438 probably benign Het
Taf1a A G 1: 183,409,276 T66A Het
Tfg A T 16: 56,712,609 probably null Het
Trim34b A G 7: 104,336,397 N413S probably benign Het
Txndc15 T A 13: 55,721,586 M184K probably damaging Het
Umodl1 A C 17: 30,982,332 S412R probably damaging Het
Zbtb8b T A 4: 129,432,890 M161L probably benign Het
Zfp597 A T 16: 3,866,505 V129E probably benign Het
Zfp790 T C 7: 29,828,625 I245T possibly damaging Het
Other mutations in Chd8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00572:Chd8 APN 14 52226138 missense probably damaging 0.99
IGL00694:Chd8 APN 14 52217970 missense probably damaging 1.00
IGL01011:Chd8 APN 14 52231532 missense possibly damaging 0.86
IGL01022:Chd8 APN 14 52236993 missense probably benign
IGL01066:Chd8 APN 14 52217766 missense probably damaging 1.00
IGL01083:Chd8 APN 14 52221420 missense probably damaging 1.00
IGL01313:Chd8 APN 14 52210575 missense probably damaging 1.00
IGL01396:Chd8 APN 14 52204587 unclassified probably benign
IGL01476:Chd8 APN 14 52205490 missense probably benign 0.32
IGL01731:Chd8 APN 14 52212654 missense probably benign 0.12
IGL01895:Chd8 APN 14 52199094 missense probably benign 0.00
IGL02090:Chd8 APN 14 52227234 critical splice donor site probably null
IGL02344:Chd8 APN 14 52201650 missense probably damaging 1.00
IGL02573:Chd8 APN 14 52219734 missense possibly damaging 0.95
IGL02601:Chd8 APN 14 52214300 missense possibly damaging 0.94
IGL02617:Chd8 APN 14 52235191 missense probably benign 0.34
IGL02873:Chd8 APN 14 52222513 missense probably damaging 0.99
IGL02974:Chd8 APN 14 52201701 splice site probably null
IGL03058:Chd8 APN 14 52218273 missense probably damaging 1.00
IGL03076:Chd8 APN 14 52226162 splice site probably benign
IGL03239:Chd8 APN 14 52227548 missense possibly damaging 0.92
PIT4431001:Chd8 UTSW 14 52218249 missense probably damaging 0.98
PIT4468001:Chd8 UTSW 14 52207996 missense probably benign
PIT4468001:Chd8 UTSW 14 52217881 missense possibly damaging 0.95
R0006:Chd8 UTSW 14 52235293 missense possibly damaging 0.51
R0006:Chd8 UTSW 14 52235293 missense possibly damaging 0.51
R0022:Chd8 UTSW 14 52232855 missense probably benign 0.00
R0115:Chd8 UTSW 14 52237206 missense probably benign 0.00
R0131:Chd8 UTSW 14 52205326 missense probably benign 0.15
R0131:Chd8 UTSW 14 52205326 missense probably benign 0.15
R0132:Chd8 UTSW 14 52205326 missense probably benign 0.15
R0419:Chd8 UTSW 14 52204060 missense probably benign 0.24
R0440:Chd8 UTSW 14 52204826 missense possibly damaging 0.91
R0452:Chd8 UTSW 14 52214587 missense probably damaging 1.00
R0481:Chd8 UTSW 14 52237206 missense probably benign 0.00
R0624:Chd8 UTSW 14 52219757 missense possibly damaging 0.65
R0650:Chd8 UTSW 14 52202304 missense probably benign 0.09
R0691:Chd8 UTSW 14 52213433 missense probably damaging 0.96
R0790:Chd8 UTSW 14 52204025 missense probably benign 0.07
R0835:Chd8 UTSW 14 52204025 missense probably benign 0.07
R1180:Chd8 UTSW 14 52221108 missense probably damaging 1.00
R1411:Chd8 UTSW 14 52224646 missense probably benign
R1725:Chd8 UTSW 14 52232573 missense probably benign 0.08
R1838:Chd8 UTSW 14 52204883 missense probably benign 0.11
R1839:Chd8 UTSW 14 52204883 missense probably benign 0.11
R1968:Chd8 UTSW 14 52220993 missense probably damaging 0.98
R2020:Chd8 UTSW 14 52215241 missense probably damaging 1.00
R2024:Chd8 UTSW 14 52231493 missense probably benign 0.23
R2139:Chd8 UTSW 14 52236971 missense probably benign 0.32
R2163:Chd8 UTSW 14 52198818 missense possibly damaging 0.53
R2342:Chd8 UTSW 14 52205217 missense probably benign 0.25
R2844:Chd8 UTSW 14 52204495 missense possibly damaging 0.92
R3500:Chd8 UTSW 14 52205653 missense probably benign 0.00
R3861:Chd8 UTSW 14 52237121 missense probably benign 0.13
R4154:Chd8 UTSW 14 52207211 unclassified probably benign
R4445:Chd8 UTSW 14 52204527 splice site probably null
R4628:Chd8 UTSW 14 52206915 missense probably benign 0.03
R4779:Chd8 UTSW 14 52231506 missense probably damaging 1.00
R4783:Chd8 UTSW 14 52205368 missense probably damaging 1.00
R4784:Chd8 UTSW 14 52205368 missense probably damaging 1.00
R5001:Chd8 UTSW 14 52203915 missense probably benign 0.09
R5280:Chd8 UTSW 14 52205125 missense possibly damaging 0.68
R5331:Chd8 UTSW 14 52202114 intron probably benign
R5348:Chd8 UTSW 14 52232698 missense probably damaging 1.00
R5375:Chd8 UTSW 14 52204154 missense probably damaging 1.00
R5470:Chd8 UTSW 14 52212609 missense probably damaging 1.00
R5479:Chd8 UTSW 14 52215195 missense probably benign 0.15
R5488:Chd8 UTSW 14 52213048 intron probably benign
R5489:Chd8 UTSW 14 52213048 intron probably benign
R5499:Chd8 UTSW 14 52204431 critical splice donor site probably null
R5988:Chd8 UTSW 14 52217938 missense probably damaging 1.00
R6046:Chd8 UTSW 14 52221071 missense possibly damaging 0.60
R6125:Chd8 UTSW 14 52207034 missense probably benign 0.16
R6212:Chd8 UTSW 14 52201698 missense probably damaging 1.00
R6337:Chd8 UTSW 14 52204109 missense probably damaging 1.00
R6394:Chd8 UTSW 14 52202585 missense possibly damaging 0.66
R6576:Chd8 UTSW 14 52216076 missense probably damaging 1.00
R6590:Chd8 UTSW 14 52227237 missense possibly damaging 0.60
R6690:Chd8 UTSW 14 52227237 missense possibly damaging 0.60
R6786:Chd8 UTSW 14 52226668 missense probably benign 0.33
R6913:Chd8 UTSW 14 52214494 missense probably damaging 0.99
R7090:Chd8 UTSW 14 52215220 missense probably damaging 0.99
R7107:Chd8 UTSW 14 52212672 missense probably benign 0.07
R7138:Chd8 UTSW 14 52214498 missense possibly damaging 0.83
R7383:Chd8 UTSW 14 52215319 missense probably damaging 1.00
R7471:Chd8 UTSW 14 52204112 missense probably benign
R7625:Chd8 UTSW 14 52237077 missense probably benign 0.04
R7790:Chd8 UTSW 14 52226082 missense probably damaging 1.00
R7862:Chd8 UTSW 14 52214277 missense probably damaging 1.00
R7937:Chd8 UTSW 14 52227506 missense probably benign 0.02
R8092:Chd8 UTSW 14 52217727 missense probably damaging 1.00
R8237:Chd8 UTSW 14 52213352 missense probably damaging 1.00
R8321:Chd8 UTSW 14 52232567 missense probably benign 0.01
R8371:Chd8 UTSW 14 52232818 missense probably benign
R8425:Chd8 UTSW 14 52210555 missense probably damaging 1.00
R8674:Chd8 UTSW 14 52213006 missense probably damaging 0.98
R8794:Chd8 UTSW 14 52204447 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- GGCAGCTCATCCTCATTCAG -3'
(R):5'- GGATCTAGGTTCAGTGAGTCTTAAC -3'

Sequencing Primer
(F):5'- CTCATTCAGGACTCGAGGTATG -3'
(R):5'- ATATAGGCCAGCTTGACCTTGAGC -3'
Posted On2019-09-13