Incidental Mutation 'R0648:Impdh2'
ID 57354
Institutional Source Beutler Lab
Gene Symbol Impdh2
Ensembl Gene ENSMUSG00000062867
Gene Name inosine monophosphate dehydrogenase 2
Synonyms IMP dehydrogenase type II
MMRRC Submission 038833-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R0648 (G1)
Quality Score 225
Status Validated
Chromosome 9
Chromosomal Location 108437635-108442776 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 108440665 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Histidine at position 83 (Y83H)
Ref Sequence ENSEMBL: ENSMUSP00000142305 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000006851] [ENSMUST00000074208] [ENSMUST00000081111] [ENSMUST00000112155] [ENSMUST00000194904] [ENSMUST00000194381] [ENSMUST00000193421]
AlphaFold P24547
Predicted Effect probably benign
Transcript: ENSMUST00000006851
SMART Domains Protein: ENSMUSP00000006851
Gene: ENSMUSG00000006673

DomainStartEndE-ValueType
low complexity region 79 123 N/A INTRINSIC
low complexity region 128 146 N/A INTRINSIC
low complexity region 150 192 N/A INTRINSIC
low complexity region 419 443 N/A INTRINSIC
low complexity region 457 478 N/A INTRINSIC
Pfam:DUF3504 597 761 1.8e-65 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000074208
SMART Domains Protein: ENSMUSP00000073832
Gene: ENSMUSG00000070283

DomainStartEndE-ValueType
Pfam:DUF498 61 169 9.3e-37 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000081111
AA Change: Y289H

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000079888
Gene: ENSMUSG00000062867
AA Change: Y289H

DomainStartEndE-ValueType
IMPDH 28 504 7.39e-260 SMART
CBS 117 168 9.4e-7 SMART
CBS 184 232 1.57e-8 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000112155
SMART Domains Protein: ENSMUSP00000107782
Gene: ENSMUSG00000006673

DomainStartEndE-ValueType
low complexity region 79 123 N/A INTRINSIC
low complexity region 128 146 N/A INTRINSIC
low complexity region 150 192 N/A INTRINSIC
low complexity region 419 443 N/A INTRINSIC
low complexity region 457 478 N/A INTRINSIC
Pfam:DUF3504 600 760 2.3e-64 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000175174
Predicted Effect noncoding transcript
Transcript: ENSMUST00000193193
Predicted Effect probably benign
Transcript: ENSMUST00000194904
AA Change: Y83H

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)
SMART Domains Protein: ENSMUSP00000142305
Gene: ENSMUSG00000062867
AA Change: Y83H

DomainStartEndE-ValueType
IMPDH 1 319 5e-122 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000194689
Predicted Effect noncoding transcript
Transcript: ENSMUST00000194666
Predicted Effect noncoding transcript
Transcript: ENSMUST00000194365
Predicted Effect noncoding transcript
Transcript: ENSMUST00000194139
Predicted Effect noncoding transcript
Transcript: ENSMUST00000193535
Predicted Effect noncoding transcript
Transcript: ENSMUST00000194104
Predicted Effect noncoding transcript
Transcript: ENSMUST00000193493
Predicted Effect noncoding transcript
Transcript: ENSMUST00000193242
Predicted Effect noncoding transcript
Transcript: ENSMUST00000194387
Predicted Effect probably benign
Transcript: ENSMUST00000194381
Predicted Effect probably benign
Transcript: ENSMUST00000193421
SMART Domains Protein: ENSMUSP00000142117
Gene: ENSMUSG00000062867

DomainStartEndE-ValueType
IMPDH 28 248 1.3e-18 SMART
CBS 92 143 4.5e-9 SMART
CBS 159 207 7.6e-11 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000196210
Predicted Effect noncoding transcript
Transcript: ENSMUST00000195456
Meta Mutation Damage Score 0.0709 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.6%
  • 20x: 96.0%
Validation Efficiency 100% (80/80)
MGI Phenotype PHENOTYPE: Mice homozygous for disruptions in this gene have abnormalities resulting in embryonic lethality around the time of implantation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc5 A G 16: 20,184,632 (GRCm39) V1009A possibly damaging Het
Acta2 T C 19: 34,225,934 (GRCm39) I87V probably benign Het
Arid1a A G 4: 133,412,515 (GRCm39) Y1560H unknown Het
Bcor C T X: 11,925,290 (GRCm39) R102Q probably damaging Het
Camsap2 A T 1: 136,232,057 (GRCm39) D179E probably damaging Het
Ccdc168 A G 1: 44,095,723 (GRCm39) S1792P possibly damaging Het
Ccdc18 T A 5: 108,283,426 (GRCm39) S46T probably damaging Het
Ccdc18 A C 5: 108,322,853 (GRCm39) Q651P probably damaging Het
Cdc73 T C 1: 143,571,200 (GRCm39) T80A probably benign Het
Cdh20 T A 1: 109,993,337 (GRCm39) probably benign Het
Cenpe G A 3: 134,935,843 (GRCm39) G426D probably damaging Het
Cenpt A G 8: 106,571,592 (GRCm39) V487A probably damaging Het
Clec2m A G 6: 129,307,932 (GRCm39) F46L probably benign Het
Col4a1 G A 8: 11,296,892 (GRCm39) P84S unknown Het
Dennd2d A G 3: 106,407,871 (GRCm39) I450M probably damaging Het
Dhps C A 8: 85,799,911 (GRCm39) probably null Het
Ebf1 A T 11: 44,882,337 (GRCm39) H431L probably damaging Het
Efcab6 A G 15: 83,817,265 (GRCm39) probably benign Het
Egflam T C 15: 7,237,190 (GRCm39) H990R probably damaging Het
Ercc6l2 A G 13: 63,992,459 (GRCm39) T303A probably benign Het
Fam167b T C 4: 129,472,150 (GRCm39) K7E probably benign Het
Fgd3 T C 13: 49,450,049 (GRCm39) I67V probably benign Het
Fhip1a A C 3: 85,637,921 (GRCm39) V126G probably damaging Het
Fn1 A T 1: 71,636,744 (GRCm39) V2045D possibly damaging Het
Gnl1 A G 17: 36,293,490 (GRCm39) N225S probably damaging Het
Gpx6 A T 13: 21,503,047 (GRCm39) N154Y probably benign Het
H2bc21 A G 3: 96,128,851 (GRCm39) S124G probably benign Het
Haus8 C A 8: 71,709,174 (GRCm39) G79V probably damaging Het
Hdgfl1 A T 13: 26,953,836 (GRCm39) L79Q probably damaging Het
Lama2 T C 10: 26,865,372 (GRCm39) T2929A probably benign Het
Lpin2 T C 17: 71,536,307 (GRCm39) S199P probably benign Het
Moap1 T C 12: 102,708,776 (GRCm39) T258A probably benign Het
Mrps35 C A 6: 146,957,443 (GRCm39) S156* probably null Het
Mrtfa A G 15: 80,901,121 (GRCm39) S457P probably damaging Het
Mtbp C T 15: 55,466,597 (GRCm39) P537S probably benign Het
Ncstn C A 1: 171,895,454 (GRCm39) V565F probably benign Het
Nhsl1 A G 10: 18,407,474 (GRCm39) N1536S possibly damaging Het
Nkain4 T C 2: 180,584,905 (GRCm39) Q103R possibly damaging Het
Nsun2 T A 13: 69,775,706 (GRCm39) N383K probably damaging Het
Or13p4 C T 4: 118,547,269 (GRCm39) V127I probably benign Het
Or6c33 A G 10: 129,853,350 (GRCm39) N40S probably damaging Het
Parp1 C T 1: 180,428,005 (GRCm39) probably benign Het
Pkd1 G A 17: 24,813,911 (GRCm39) R4125H probably damaging Het
Plxnd1 T C 6: 115,970,962 (GRCm39) I269V possibly damaging Het
Polr1f C T 12: 33,487,999 (GRCm39) Q305* probably null Het
Ppp1r36dn A G 12: 76,498,070 (GRCm39) noncoding transcript Het
Qrich1 T A 9: 108,422,076 (GRCm39) N563K probably damaging Het
Rab3il1 TGAAG TGAAGAAG 19: 10,004,752 (GRCm39) probably benign Het
Rell1 G A 5: 64,082,088 (GRCm39) T271M probably benign Het
Rgl1 A G 1: 152,412,016 (GRCm39) probably null Het
Rph3a C T 5: 121,097,333 (GRCm39) R261H possibly damaging Het
Ryr2 A T 13: 11,739,219 (GRCm39) M2161K possibly damaging Het
Scaf11 T C 15: 96,316,339 (GRCm39) N1075S possibly damaging Het
Serpina3j A G 12: 104,280,938 (GRCm39) D37G probably benign Het
Siah2 A G 3: 58,583,635 (GRCm39) V217A probably damaging Het
Sik2 T C 9: 50,810,045 (GRCm39) D506G probably benign Het
Skap2 A C 6: 51,856,765 (GRCm39) V279G probably benign Het
Slc8a3 G T 12: 81,361,220 (GRCm39) T533N probably damaging Het
Slc9a7 A T X: 20,028,659 (GRCm39) probably benign Het
Snai3 G T 8: 123,181,733 (GRCm39) F241L probably damaging Het
Speg T C 1: 75,404,622 (GRCm39) S2805P probably benign Het
Spink5 A T 18: 44,132,864 (GRCm39) probably benign Het
Tctn1 C T 5: 122,389,761 (GRCm39) E254K probably benign Het
Tdrd3 C T 14: 87,709,618 (GRCm39) T100M probably damaging Het
Tex47 T C 5: 7,355,215 (GRCm39) V132A probably benign Het
Thbs3 A G 3: 89,123,972 (GRCm39) probably null Het
Tigit T A 16: 43,482,401 (GRCm39) Y111F probably damaging Het
Tmem245 A G 4: 56,906,270 (GRCm39) I148T probably benign Het
Tmem97 A G 11: 78,441,365 (GRCm39) Y39H probably benign Het
Tnks2 T A 19: 36,839,474 (GRCm39) probably null Het
Trp53bp1 A G 2: 121,066,188 (GRCm39) V846A probably benign Het
Tulp2 T G 7: 45,169,210 (GRCm39) I259S probably damaging Het
Ubxn1 G A 19: 8,851,612 (GRCm39) R215H probably damaging Het
Vmn1r17 A G 6: 57,337,460 (GRCm39) F253L probably damaging Het
Vmn2r10 T C 5: 109,143,782 (GRCm39) M723V probably benign Het
Xndc1 T C 7: 101,728,031 (GRCm39) V14A possibly damaging Het
Xpnpep1 A G 19: 52,986,294 (GRCm39) probably benign Het
Yes1 T A 5: 32,812,862 (GRCm39) M322K possibly damaging Het
Zdhhc14 C A 17: 5,543,877 (GRCm39) N52K probably benign Het
Zfp42 A G 8: 43,749,015 (GRCm39) V162A probably benign Het
Other mutations in Impdh2
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0032:Impdh2 UTSW 9 108,438,860 (GRCm39) missense probably damaging 1.00
R0523:Impdh2 UTSW 9 108,439,019 (GRCm39) missense possibly damaging 0.80
R0523:Impdh2 UTSW 9 108,439,018 (GRCm39) splice site probably null
R0644:Impdh2 UTSW 9 108,440,836 (GRCm39) missense possibly damaging 0.56
R0905:Impdh2 UTSW 9 108,438,296 (GRCm39) unclassified probably benign
R1173:Impdh2 UTSW 9 108,439,028 (GRCm39) missense probably benign 0.19
R1202:Impdh2 UTSW 9 108,440,386 (GRCm39) missense probably damaging 1.00
R1441:Impdh2 UTSW 9 108,441,975 (GRCm39) missense probably benign 0.12
R1818:Impdh2 UTSW 9 108,440,411 (GRCm39) splice site probably null
R2141:Impdh2 UTSW 9 108,442,546 (GRCm39) missense possibly damaging 0.50
R2173:Impdh2 UTSW 9 108,442,593 (GRCm39) splice site probably null
R2438:Impdh2 UTSW 9 108,437,815 (GRCm39) missense probably benign 0.06
R4061:Impdh2 UTSW 9 108,440,003 (GRCm39) missense possibly damaging 0.46
R4273:Impdh2 UTSW 9 108,442,155 (GRCm39) missense probably damaging 1.00
R4847:Impdh2 UTSW 9 108,442,714 (GRCm39) missense probably benign 0.00
R4847:Impdh2 UTSW 9 108,441,870 (GRCm39) missense probably damaging 1.00
R5073:Impdh2 UTSW 9 108,440,535 (GRCm39) critical splice donor site probably null
R5896:Impdh2 UTSW 9 108,441,165 (GRCm39) missense probably benign 0.06
R6315:Impdh2 UTSW 9 108,440,638 (GRCm39) missense possibly damaging 0.66
R7172:Impdh2 UTSW 9 108,437,809 (GRCm39) missense probably benign 0.00
R7182:Impdh2 UTSW 9 108,440,407 (GRCm39) missense possibly damaging 0.56
R7241:Impdh2 UTSW 9 108,440,636 (GRCm39) missense possibly damaging 0.78
R7640:Impdh2 UTSW 9 108,442,380 (GRCm39) missense possibly damaging 0.84
R7969:Impdh2 UTSW 9 108,439,505 (GRCm39) nonsense probably null
R8079:Impdh2 UTSW 9 108,440,524 (GRCm39) missense probably benign 0.01
R8728:Impdh2 UTSW 9 108,437,562 (GRCm39) unclassified probably benign
R8735:Impdh2 UTSW 9 108,441,978 (GRCm39) critical splice donor site probably null
R8821:Impdh2 UTSW 9 108,441,957 (GRCm39) missense probably damaging 0.99
R8831:Impdh2 UTSW 9 108,441,957 (GRCm39) missense probably damaging 0.99
R9355:Impdh2 UTSW 9 108,442,402 (GRCm39) missense probably benign 0.35
R9697:Impdh2 UTSW 9 108,438,847 (GRCm39) missense possibly damaging 0.86
X0066:Impdh2 UTSW 9 108,438,986 (GRCm39) missense probably benign 0.33
Predicted Primers PCR Primer
(F):5'- CATCATTGCCCGGACAGACCTAAAG -3'
(R):5'- TGCCGACTCGCAAAGCATCTAC -3'

Sequencing Primer
(F):5'- TGACAAGTATAGGCTGGACTTACTG -3'
(R):5'- GCATCTACACCTGCATCTATGAGG -3'
Posted On 2013-07-11