Incidental Mutation 'R7392:Olfr284'
ID573545
Institutional Source Beutler Lab
Gene Symbol Olfr284
Ensembl Gene ENSMUSG00000051793
Gene Nameolfactory receptor 284
SynonymsMOR160-4, GA_x6K02T2NBG7-5395976-5396893
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.073) question?
Stock #R7392 (G1)
Quality Score225.009
Status Not validated
Chromosome15
Chromosomal Location98340022-98340987 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 98340311 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 226 (V226A)
Ref Sequence ENSEMBL: ENSMUSP00000145864 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000063289] [ENSMUST00000206647]
Predicted Effect probably benign
Transcript: ENSMUST00000063289
AA Change: V210A

PolyPhen 2 Score 0.026 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000065626
Gene: ENSMUSG00000051793
AA Change: V210A

DomainStartEndE-ValueType
Pfam:7tm_4 29 304 5.3e-54 PFAM
Pfam:7TM_GPCR_Srsx 33 259 1.3e-5 PFAM
Pfam:7tm_1 39 286 5e-21 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000206647
AA Change: V226A

PolyPhen 2 Score 0.028 (Sensitivity: 0.95; Specificity: 0.81)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.8%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 83 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610021A01Rik T A 7: 41,626,566 F564L probably damaging Het
4930539E08Rik A T 17: 28,908,377 D219E probably benign Het
9530053A07Rik C T 7: 28,164,372 T2523M possibly damaging Het
Abcc2 T C 19: 43,808,687 I499T probably damaging Het
Adamts13 C T 2: 26,989,324 R630C probably damaging Het
Adgrv1 A T 13: 81,560,689 F1199I probably damaging Het
Agbl5 G A 5: 30,890,771 probably null Het
Anks1b A G 10: 90,680,786 D881G possibly damaging Het
Arap2 A T 5: 62,698,385 S569R possibly damaging Het
Arhgap15 T C 2: 44,063,774 S171P possibly damaging Het
Arhgef11 G A 3: 87,717,175 probably null Het
Baz1a C A 12: 54,898,765 L1271F probably damaging Het
Bdnf A C 2: 109,723,930 K216N probably benign Het
Bmp7 C T 2: 172,870,205 D409N probably damaging Het
Cacna1c T A 6: 118,741,920 I390F Het
Chd8 A G 14: 52,232,855 S433P probably benign Het
Clrn2 A G 5: 45,463,909 E215G possibly damaging Het
Col19a1 T G 1: 24,534,034 D219A unknown Het
Col2a1 G A 15: 97,980,151 R1036* probably null Het
Copg1 T A 6: 87,890,275 V110D probably benign Het
Cpd C T 11: 76,801,779 G744D probably damaging Het
Crygs G A 16: 22,806,502 P63L probably benign Het
Dcn A G 10: 97,509,998 D224G probably damaging Het
Dnah7a T C 1: 53,501,661 E2518G probably benign Het
Efcab6 C A 15: 83,988,951 R197L probably benign Het
Efr3b T A 12: 3,969,588 Y723F probably benign Het
Enam A G 5: 88,501,664 N344S probably damaging Het
Erich4 A G 7: 25,615,676 I58T possibly damaging Het
Esrp1 A G 4: 11,338,809 V665A probably benign Het
Etf1 G A 18: 34,906,050 T388I probably benign Het
Faf1 A G 4: 109,794,843 T244A probably benign Het
Fam129a A G 1: 151,696,224 T307A probably damaging Het
Fbn1 T C 2: 125,343,924 D1610G probably damaging Het
Frem1 G T 4: 83,013,827 F212L probably benign Het
Fuom T A 7: 140,101,160 D85V probably damaging Het
Gcfc2 T C 6: 81,943,012 probably null Het
Gpr37 C T 6: 25,688,787 A104T probably benign Het
Hsp90ab1 G C 17: 45,569,048 T514S probably benign Het
Ifnl2 A G 7: 28,509,669 F74L probably benign Het
Ipo11 G A 13: 106,891,691 R367* probably null Het
Itpr2 T C 6: 146,359,340 D963G possibly damaging Het
Krt15 A T 11: 100,135,560 V100E possibly damaging Het
Lrch3 T A 16: 32,986,755 L466* probably null Het
Lrfn5 A T 12: 61,840,304 T293S probably benign Het
Lrp5 A G 19: 3,610,199 I955T probably damaging Het
Lrrc4b C T 7: 44,462,015 T437M probably damaging Het
Man1a A G 10: 53,919,187 Y657H probably damaging Het
Mapkap1 G T 2: 34,435,154 R94L probably damaging Het
Mtmr4 T A 11: 87,604,557 L480Q probably damaging Het
Mycbp2 T C 14: 103,152,191 I3504M probably damaging Het
Mycbp2 A T 14: 103,243,128 C1169S probably damaging Het
Myo15 T C 11: 60,505,976 S1455P Het
Nid2 A G 14: 19,768,656 D406G probably benign Het
Nrip2 A G 6: 128,404,950 I69V probably benign Het
Nthl1 G A 17: 24,638,624 V266I probably benign Het
Olfr1000 A C 2: 85,608,488 C141G possibly damaging Het
Olfr1061 A G 2: 86,413,152 V300A probably benign Het
Olfr1440 G T 19: 12,394,465 L67F probably damaging Het
Olfr1444 A G 19: 12,862,587 T271A probably benign Het
Olfr501-ps1 C A 7: 108,508,084 H9Q possibly damaging Het
Olfr698 T C 7: 106,753,382 E2G possibly damaging Het
Pcdhb1 A C 18: 37,265,118 S41R possibly damaging Het
Pdcd11 T A 19: 47,127,997 F1529I probably damaging Het
Plcd3 C A 11: 103,101,557 probably benign Het
Qdpr T C 5: 45,439,376 M149V probably benign Het
R3hcc1 T A 14: 69,705,880 probably null Het
Rasgrf2 T C 13: 91,893,737 Y392C Het
Slc8a3 A C 12: 81,314,803 V414G probably damaging Het
Slco1a6 A G 6: 142,157,277 S54P probably benign Het
Sos1 C A 17: 80,424,200 V624F probably damaging Het
Spdef T C 17: 27,717,288 D227G probably benign Het
Sptb G T 12: 76,624,229 Q447K probably damaging Het
Srsf12 A T 4: 33,209,265 R62W unknown Het
Stag3 T C 5: 138,291,366 L266P probably damaging Het
Sult2b1 T C 7: 45,742,438 probably benign Het
Taf1a A G 1: 183,409,276 T66A Het
Tfg A T 16: 56,712,609 probably null Het
Trim34b A G 7: 104,336,397 N413S probably benign Het
Txndc15 T A 13: 55,721,586 M184K probably damaging Het
Umodl1 A C 17: 30,982,332 S412R probably damaging Het
Zbtb8b T A 4: 129,432,890 M161L probably benign Het
Zfp597 A T 16: 3,866,505 V129E probably benign Het
Zfp790 T C 7: 29,828,625 I245T possibly damaging Het
Other mutations in Olfr284
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00231:Olfr284 APN 15 98340173 missense possibly damaging 0.47
IGL02904:Olfr284 APN 15 98340848 missense probably null 0.88
PIT4378001:Olfr284 UTSW 15 98340272 missense possibly damaging 0.95
R0485:Olfr284 UTSW 15 98340929 missense probably benign 0.01
R1435:Olfr284 UTSW 15 98340328 missense possibly damaging 0.69
R4706:Olfr284 UTSW 15 98340778 missense possibly damaging 0.62
R4707:Olfr284 UTSW 15 98340778 missense possibly damaging 0.62
R5272:Olfr284 UTSW 15 98340365 missense probably benign 0.00
R5314:Olfr284 UTSW 15 98340365 missense probably benign 0.00
R5315:Olfr284 UTSW 15 98340365 missense probably benign 0.00
R5316:Olfr284 UTSW 15 98340365 missense probably benign 0.00
R5317:Olfr284 UTSW 15 98340365 missense probably benign 0.00
R5456:Olfr284 UTSW 15 98340365 missense probably benign 0.00
R5458:Olfr284 UTSW 15 98340365 missense probably benign 0.00
R5548:Olfr284 UTSW 15 98340372 missense probably benign 0.21
R5717:Olfr284 UTSW 15 98340365 missense probably benign 0.00
R5921:Olfr284 UTSW 15 98340429 missense probably benign 0.10
R6519:Olfr284 UTSW 15 98340048 missense probably benign 0.00
R6636:Olfr284 UTSW 15 98340950 missense probably benign 0.23
R7112:Olfr284 UTSW 15 98340540 missense possibly damaging 0.81
R7289:Olfr284 UTSW 15 98340062 missense probably damaging 1.00
R7403:Olfr284 UTSW 15 98340119 missense probably damaging 1.00
R7633:Olfr284 UTSW 15 98340086 missense probably damaging 1.00
R7724:Olfr284 UTSW 15 98340894 missense possibly damaging 0.89
Predicted Primers PCR Primer
(F):5'- GTACTGCAGAGAGAAGACCTTC -3'
(R):5'- ATGAGTAGCCAGCTCTGTGTG -3'

Sequencing Primer
(F):5'- GATAAACCCCGAGCCATAG -3'
(R):5'- GCTGTTGTGGATGCTCTCCTC -3'
Posted On2019-09-13