Incidental Mutation 'R7393:Nrp2'
ID573564
Institutional Source Beutler Lab
Gene Symbol Nrp2
Ensembl Gene ENSMUSG00000025969
Gene Nameneuropilin 2
SynonymsNpn2, NP-2, NP2, Npn-2, 1110048P06Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.950) question?
Stock #R7393 (G1)
Quality Score225.009
Status Not validated
Chromosome1
Chromosomal Location62703285-62818695 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 62745424 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 244 (I244T)
Ref Sequence ENSEMBL: ENSMUSP00000109794 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027112] [ENSMUST00000063594] [ENSMUST00000075144] [ENSMUST00000102822] [ENSMUST00000114155] [ENSMUST00000114157]
Predicted Effect possibly damaging
Transcript: ENSMUST00000027112
AA Change: I244T

PolyPhen 2 Score 0.943 (Sensitivity: 0.80; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000027112
Gene: ENSMUSG00000025969
AA Change: I244T

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
CUB 28 142 3.4e-45 SMART
CUB 149 267 1.04e-40 SMART
FA58C 276 427 1.63e-45 SMART
FA58C 433 592 9.33e-14 SMART
MAM 641 802 2.31e-60 SMART
Pfam:DUF3481 822 906 1.4e-35 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000063594
AA Change: I244T

PolyPhen 2 Score 0.943 (Sensitivity: 0.80; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000069379
Gene: ENSMUSG00000025969
AA Change: I244T

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
CUB 28 142 3.4e-45 SMART
CUB 149 267 1.04e-40 SMART
FA58C 276 427 1.63e-45 SMART
FA58C 433 592 9.33e-14 SMART
MAM 641 802 2.31e-60 SMART
low complexity region 816 831 N/A INTRINSIC
Pfam:DUF3481 839 923 1.6e-25 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000075144
AA Change: I244T

PolyPhen 2 Score 0.954 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000074642
Gene: ENSMUSG00000025969
AA Change: I244T

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
CUB 28 142 3.4e-45 SMART
CUB 149 267 1.04e-40 SMART
FA58C 276 427 1.63e-45 SMART
FA58C 433 592 9.33e-14 SMART
MAM 641 802 2.31e-60 SMART
Pfam:DUF3481 827 911 2.3e-25 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000102822
AA Change: I244T

PolyPhen 2 Score 0.064 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000099886
Gene: ENSMUSG00000025969
AA Change: I244T

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
CUB 28 142 3.4e-45 SMART
CUB 149 267 1.04e-40 SMART
FA58C 276 427 1.63e-45 SMART
FA58C 433 592 9.33e-14 SMART
MAM 641 802 2.31e-60 SMART
Pfam:DUF3481 822 906 2.3e-25 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000114155
AA Change: I244T

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000109792
Gene: ENSMUSG00000025969
AA Change: I244T

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
CUB 28 142 3.4e-45 SMART
CUB 149 267 1.04e-40 SMART
FA58C 276 427 1.63e-45 SMART
FA58C 433 592 9.33e-14 SMART
MAM 641 802 2.31e-60 SMART
Pfam:DUF3481 817 901 9.4e-36 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000114157
AA Change: I244T

PolyPhen 2 Score 0.978 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000109794
Gene: ENSMUSG00000025969
AA Change: I244T

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
CUB 28 142 3.4e-45 SMART
CUB 149 267 1.04e-40 SMART
FA58C 276 427 1.63e-45 SMART
FA58C 433 592 9.33e-14 SMART
MAM 641 802 2.31e-60 SMART
low complexity region 821 836 N/A INTRINSIC
Pfam:DUF3481 844 928 2.4e-25 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the neuropilin family of receptor proteins. The encoded transmembrane protein binds to SEMA3C protein {sema domain, immunoglobulin domain (Ig), short basic domain, secreted, (semaphorin) 3C} and SEMA3F protein {sema domain, immunoglobulin domain (Ig), short basic domain, secreted, (semaphorin) 3F}, and interacts with vascular endothelial growth factor (VEGF). This protein may play a role in cardiovascular development, axon guidance, and tumorigenesis. Multiple transcript variants encoding distinct isoforms have been identified for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Nullizygous mice may exhibit pre- or postnatal lethality, reduced fertility, hydrocephalus, aberrant sensory innervation, reduced interneuron count, seizure susceptibility and abnormal lymphangiogenesis. Homozygotes for a gene trap allele show abnormal neuronal development and axonal trajectories. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010107E04Rik A G 12: 111,963,277 V26A probably benign Het
Abcb11 C T 2: 69,299,867 D282N probably damaging Het
Abi2 T C 1: 60,434,382 M86T possibly damaging Het
Adam26a T C 8: 43,569,688 N255S probably benign Het
Adam4 G A 12: 81,419,660 S729L probably benign Het
Adcy1 G T 11: 7,137,381 W418C probably damaging Het
Add2 T A 6: 86,098,647 Y259* probably null Het
Agl A T 3: 116,791,156 C172S probably benign Het
Ankfy1 A G 11: 72,738,308 T319A possibly damaging Het
Armc8 A T 9: 99,483,999 C621S possibly damaging Het
Bbc3 A G 7: 16,313,789 D146G probably benign Het
Btnl10 T C 11: 58,923,706 L404P probably damaging Het
Cbl A G 9: 44,154,188 probably null Het
Ccdc170 T A 10: 4,514,314 probably null Het
Ccdc91 T A 6: 147,534,029 V37E possibly damaging Het
Ces1e G T 8: 93,210,417 T343K probably benign Het
Chfr T A 5: 110,152,358 F323I probably damaging Het
Clcnkb T A 4: 141,409,445 M370L probably benign Het
Col11a1 A G 3: 114,097,106 D364G unknown Het
Ctbp2 A G 7: 132,988,292 I381T probably benign Het
Cyp4a29 A C 4: 115,242,196 Y38S probably damaging Het
Ddx1 T C 12: 13,230,353 D382G probably benign Het
Dhx57 T A 17: 80,255,571 N876Y probably damaging Het
Dsel C T 1: 111,861,573 G411S probably damaging Het
Enpp5 G A 17: 44,085,264 G356S probably damaging Het
Fam234a T C 17: 26,216,624 D262G probably benign Het
Fnbp4 C A 2: 90,779,316 Q1035K probably damaging Het
Gbp11 T A 5: 105,327,577 N302Y possibly damaging Het
Gm11554 T A 11: 99,803,872 T172S unknown Het
Hamp2 A T 7: 30,922,605 M53K possibly damaging Het
Kcnj1 A G 9: 32,397,018 D246G probably damaging Het
Kctd20 T C 17: 28,963,338 F209L probably damaging Het
Klra2 T C 6: 131,230,202 Y148C probably damaging Het
Krtap15 T C 16: 88,829,097 probably null Het
Mrps23 T C 11: 88,204,458 L6P probably damaging Het
Ms4a6d G A 19: 11,590,073 Q155* probably null Het
Myo7a G A 7: 98,063,699 R1690C possibly damaging Het
Nbas T C 12: 13,393,492 S1183P probably damaging Het
Ndufaf4 T A 4: 24,903,177 M122K probably benign Het
Nop2 C A 6: 125,133,546 S45* probably null Het
Nop56 T A 2: 130,274,638 L3Q probably benign Het
Olfr1426 T A 19: 12,088,628 T55S probably benign Het
Olfr620 A G 7: 103,611,991 S121P possibly damaging Het
Otof T C 5: 30,370,270 D1941G probably benign Het
Pcyox1l T C 18: 61,697,641 K387E probably benign Het
Plcg2 A G 8: 117,579,825 Y306C possibly damaging Het
Ppp1r13b G A 12: 111,838,754 P333S probably damaging Het
Rcc2 A G 4: 140,717,030 D344G probably damaging Het
Reln A T 5: 21,976,351 N1810K probably damaging Het
Rfesd G T 13: 76,003,030 A90E probably benign Het
Rsf1 CGGCGGCGG CGGCGGCGGGGGCGGCGG 7: 97,579,917 probably benign Het
Scg2 T C 1: 79,435,231 K552E probably damaging Het
Sdccag8 A G 1: 176,840,306 I190V probably benign Het
Sele C A 1: 164,053,923 T533K probably benign Het
Sh3bp4 T A 1: 89,144,448 H339Q possibly damaging Het
Slc6a19 A G 13: 73,692,974 S106P probably benign Het
Spidr C T 16: 16,146,831 probably benign Het
Stk36 A T 1: 74,611,193 K295* probably null Het
Synj1 A T 16: 90,951,999 D1056E probably damaging Het
Tnks1bp1 T C 2: 85,062,866 S1046P probably benign Het
Ttc27 T G 17: 74,770,264 F385V possibly damaging Het
Ttn C A 2: 76,944,345 G2164W unknown Het
Ubap1 T A 4: 41,379,764 L326* probably null Het
Ubr4 A G 4: 139,426,785 N812S probably damaging Het
Vmn1r160 A G 7: 22,871,353 T44A possibly damaging Het
Vmn1r28 G A 6: 58,265,589 S139N possibly damaging Het
Vmn2r116 A G 17: 23,386,125 I137M probably benign Het
Vmn2r67 A T 7: 85,155,878 W9R probably null Het
Zfp101 T C 17: 33,386,700 N45D possibly damaging Het
Other mutations in Nrp2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00765:Nrp2 APN 1 62704251 nonsense probably null
IGL01912:Nrp2 APN 1 62771737 missense probably damaging 1.00
IGL01996:Nrp2 APN 1 62749260 missense probably damaging 1.00
IGL02184:Nrp2 APN 1 62718940 nonsense probably null
IGL02682:Nrp2 APN 1 62771837 missense probably benign 0.03
IGL02928:Nrp2 APN 1 62815446 missense probably damaging 1.00
IGL03024:Nrp2 APN 1 62771734 missense probably damaging 1.00
R0068:Nrp2 UTSW 1 62745377 missense possibly damaging 0.95
R0068:Nrp2 UTSW 1 62745377 missense possibly damaging 0.95
R0683:Nrp2 UTSW 1 62744318 missense probably benign 0.41
R0789:Nrp2 UTSW 1 62745450 missense probably benign 0.44
R1418:Nrp2 UTSW 1 62783332 nonsense probably null
R1468:Nrp2 UTSW 1 62738299 missense probably damaging 1.00
R1468:Nrp2 UTSW 1 62738299 missense probably damaging 1.00
R1544:Nrp2 UTSW 1 62762904 missense probably damaging 1.00
R1645:Nrp2 UTSW 1 62785124 missense probably damaging 0.97
R1677:Nrp2 UTSW 1 62783320 missense probably benign 0.18
R1752:Nrp2 UTSW 1 62738441 missense probably damaging 1.00
R1840:Nrp2 UTSW 1 62738339 missense probably damaging 1.00
R1916:Nrp2 UTSW 1 62762747 missense probably damaging 1.00
R1962:Nrp2 UTSW 1 62718931 missense probably benign 0.03
R2108:Nrp2 UTSW 1 62744277 missense probably damaging 1.00
R2164:Nrp2 UTSW 1 62744355 missense probably damaging 1.00
R2216:Nrp2 UTSW 1 62762918 nonsense probably null
R2679:Nrp2 UTSW 1 62785078 missense probably benign 0.00
R4349:Nrp2 UTSW 1 62738417 missense probably damaging 1.00
R4351:Nrp2 UTSW 1 62738417 missense probably damaging 1.00
R4352:Nrp2 UTSW 1 62738417 missense probably damaging 1.00
R4353:Nrp2 UTSW 1 62738417 missense probably damaging 1.00
R4811:Nrp2 UTSW 1 62719081 missense probably damaging 1.00
R5362:Nrp2 UTSW 1 62769062 missense probably benign 0.01
R5387:Nrp2 UTSW 1 62762813 missense probably benign 0.02
R5461:Nrp2 UTSW 1 62747211 nonsense probably null
R5704:Nrp2 UTSW 1 62785108 missense probably benign 0.00
R6143:Nrp2 UTSW 1 62760815 missense probably damaging 1.00
R6303:Nrp2 UTSW 1 62745406 missense probably damaging 1.00
R6304:Nrp2 UTSW 1 62745406 missense probably damaging 1.00
R6376:Nrp2 UTSW 1 62719017 missense possibly damaging 0.65
R6945:Nrp2 UTSW 1 62760788 missense probably damaging 1.00
R7347:Nrp2 UTSW 1 62745504 missense probably benign 0.04
R7593:Nrp2 UTSW 1 62719044 missense probably damaging 0.96
R7881:Nrp2 UTSW 1 62771831 missense probably benign 0.42
R7882:Nrp2 UTSW 1 62783521 missense probably damaging 1.00
R7948:Nrp2 UTSW 1 62745408 missense probably damaging 1.00
R7964:Nrp2 UTSW 1 62771831 missense probably benign 0.42
R7965:Nrp2 UTSW 1 62783521 missense probably damaging 1.00
R8009:Nrp2 UTSW 1 62745408 missense probably damaging 1.00
R8012:Nrp2 UTSW 1 62745408 missense probably damaging 1.00
R8014:Nrp2 UTSW 1 62745408 missense probably damaging 1.00
R8015:Nrp2 UTSW 1 62745408 missense probably damaging 1.00
R8068:Nrp2 UTSW 1 62745408 missense probably damaging 1.00
R8069:Nrp2 UTSW 1 62745408 missense probably damaging 1.00
R8070:Nrp2 UTSW 1 62745408 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGGGAAAGCACTTTTAATGTTCAGG -3'
(R):5'- AGGTCAGCCCTTTACCTGTAC -3'

Sequencing Primer
(F):5'- TCAGGGGGAATATCAGACATCATTC -3'
(R):5'- GTACGTACACCTGTCCCTAATGAG -3'
Posted On2019-09-13