Incidental Mutation 'R7393:Stk36'
ID573565
Institutional Source Beutler Lab
Gene Symbol Stk36
Ensembl Gene ENSMUSG00000033276
Gene Nameserine/threonine kinase 36
Synonyms1700112N14Rik, Fused
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7393 (G1)
Quality Score225.009
Status Not validated
Chromosome1
Chromosomal Location74601445-74636894 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) A to T at 74611193 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Stop codon at position 295 (K295*)
Ref Sequence ENSEMBL: ENSMUSP00000120020 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000087183] [ENSMUST00000087186] [ENSMUST00000148456] [ENSMUST00000189830]
Predicted Effect probably null
Transcript: ENSMUST00000087183
AA Change: K295*
SMART Domains Protein: ENSMUSP00000084430
Gene: ENSMUSG00000033276
AA Change: K295*

DomainStartEndE-ValueType
S_TKc 4 254 5.24e-100 SMART
low complexity region 405 419 N/A INTRINSIC
low complexity region 472 485 N/A INTRINSIC
low complexity region 705 718 N/A INTRINSIC
low complexity region 826 836 N/A INTRINSIC
low complexity region 852 860 N/A INTRINSIC
low complexity region 900 914 N/A INTRINSIC
low complexity region 956 969 N/A INTRINSIC
low complexity region 994 1009 N/A INTRINSIC
low complexity region 1014 1030 N/A INTRINSIC
Pfam:HEAT_2 1112 1218 7.8e-11 PFAM
Pfam:HEAT_2 1158 1259 3e-11 PFAM
Pfam:HEAT_EZ 1207 1261 4.3e-9 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000087186
AA Change: K295*
SMART Domains Protein: ENSMUSP00000084433
Gene: ENSMUSG00000033276
AA Change: K295*

DomainStartEndE-ValueType
S_TKc 4 254 5.24e-100 SMART
low complexity region 405 419 N/A INTRINSIC
low complexity region 577 590 N/A INTRINSIC
low complexity region 698 708 N/A INTRINSIC
low complexity region 724 732 N/A INTRINSIC
low complexity region 772 786 N/A INTRINSIC
low complexity region 828 841 N/A INTRINSIC
low complexity region 866 881 N/A INTRINSIC
low complexity region 886 902 N/A INTRINSIC
Pfam:HEAT_2 984 1090 2.9e-10 PFAM
Pfam:HEAT_2 1026 1131 9.6e-11 PFAM
Pfam:HEAT_EZ 1039 1092 2.2e-7 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000148456
AA Change: K295*
SMART Domains Protein: ENSMUSP00000120020
Gene: ENSMUSG00000033276
AA Change: K295*

DomainStartEndE-ValueType
S_TKc 4 254 5.24e-100 SMART
low complexity region 405 419 N/A INTRINSIC
low complexity region 472 485 N/A INTRINSIC
low complexity region 705 718 N/A INTRINSIC
low complexity region 826 836 N/A INTRINSIC
low complexity region 852 860 N/A INTRINSIC
low complexity region 898 912 N/A INTRINSIC
low complexity region 954 967 N/A INTRINSIC
low complexity region 992 1007 N/A INTRINSIC
low complexity region 1012 1028 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000189830
SMART Domains Protein: ENSMUSP00000140912
Gene: ENSMUSG00000033276

DomainStartEndE-ValueType
Pfam:Pkinase 1 56 8.1e-8 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the serine/threonine kinase family of enzymes. This family member is similar to a Drosophila protein that plays a key role in the Hedgehog signaling pathway. This human protein is a positive regulator of the GLI zinc-finger transcription factors. Knockout studies of the homologous mouse gene suggest that defects in this human gene may lead to congenital hydrocephalus, possibly due to a functional defect in motile cilia. Because Hedgehog signaling is frequently activated in certain kinds of gastrointestinal cancers, it has been suggested that this gene is a target for the treatment of these cancers. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Aug 2011]
PHENOTYPE: Nullizygous mutations cause postnatal growth defects and lethality. Homozygotes for a null allele show hydrocephaly, cranial defects, otitis media and sterility. Homozygotes for another null allele show additional defects in lung and renal development, thymus and spleen atrophy, rhinitis and ataxia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010107E04Rik A G 12: 111,963,277 V26A probably benign Het
Abcb11 C T 2: 69,299,867 D282N probably damaging Het
Abi2 T C 1: 60,434,382 M86T possibly damaging Het
Adam26a T C 8: 43,569,688 N255S probably benign Het
Adam4 G A 12: 81,419,660 S729L probably benign Het
Adcy1 G T 11: 7,137,381 W418C probably damaging Het
Add2 T A 6: 86,098,647 Y259* probably null Het
Agl A T 3: 116,791,156 C172S probably benign Het
Ankfy1 A G 11: 72,738,308 T319A possibly damaging Het
Armc8 A T 9: 99,483,999 C621S possibly damaging Het
Bbc3 A G 7: 16,313,789 D146G probably benign Het
Btnl10 T C 11: 58,923,706 L404P probably damaging Het
Cbl A G 9: 44,154,188 probably null Het
Ccdc170 T A 10: 4,514,314 probably null Het
Ccdc91 T A 6: 147,534,029 V37E possibly damaging Het
Ces1e G T 8: 93,210,417 T343K probably benign Het
Chfr T A 5: 110,152,358 F323I probably damaging Het
Clcnkb T A 4: 141,409,445 M370L probably benign Het
Col11a1 A G 3: 114,097,106 D364G unknown Het
Ctbp2 A G 7: 132,988,292 I381T probably benign Het
Cyp4a29 A C 4: 115,242,196 Y38S probably damaging Het
Ddx1 T C 12: 13,230,353 D382G probably benign Het
Dhx57 T A 17: 80,255,571 N876Y probably damaging Het
Dsel C T 1: 111,861,573 G411S probably damaging Het
Enpp5 G A 17: 44,085,264 G356S probably damaging Het
Fam234a T C 17: 26,216,624 D262G probably benign Het
Fnbp4 C A 2: 90,779,316 Q1035K probably damaging Het
Gbp11 T A 5: 105,327,577 N302Y possibly damaging Het
Gm11554 T A 11: 99,803,872 T172S unknown Het
Hamp2 A T 7: 30,922,605 M53K possibly damaging Het
Kcnj1 A G 9: 32,397,018 D246G probably damaging Het
Kctd20 T C 17: 28,963,338 F209L probably damaging Het
Klra2 T C 6: 131,230,202 Y148C probably damaging Het
Krtap15 T C 16: 88,829,097 probably null Het
Mrps23 T C 11: 88,204,458 L6P probably damaging Het
Ms4a6d G A 19: 11,590,073 Q155* probably null Het
Myo7a G A 7: 98,063,699 R1690C possibly damaging Het
Nbas T C 12: 13,393,492 S1183P probably damaging Het
Ndufaf4 T A 4: 24,903,177 M122K probably benign Het
Nop2 C A 6: 125,133,546 S45* probably null Het
Nop56 T A 2: 130,274,638 L3Q probably benign Het
Nrp2 T C 1: 62,745,424 I244T probably damaging Het
Olfr1426 T A 19: 12,088,628 T55S probably benign Het
Olfr620 A G 7: 103,611,991 S121P possibly damaging Het
Otof T C 5: 30,370,270 D1941G probably benign Het
Pcyox1l T C 18: 61,697,641 K387E probably benign Het
Plcg2 A G 8: 117,579,825 Y306C possibly damaging Het
Ppp1r13b G A 12: 111,838,754 P333S probably damaging Het
Rcc2 A G 4: 140,717,030 D344G probably damaging Het
Reln A T 5: 21,976,351 N1810K probably damaging Het
Rfesd G T 13: 76,003,030 A90E probably benign Het
Rsf1 CGGCGGCGG CGGCGGCGGGGGCGGCGG 7: 97,579,917 probably benign Het
Scg2 T C 1: 79,435,231 K552E probably damaging Het
Sdccag8 A G 1: 176,840,306 I190V probably benign Het
Sele C A 1: 164,053,923 T533K probably benign Het
Sh3bp4 T A 1: 89,144,448 H339Q possibly damaging Het
Slc6a19 A G 13: 73,692,974 S106P probably benign Het
Spidr C T 16: 16,146,831 probably benign Het
Synj1 A T 16: 90,951,999 D1056E probably damaging Het
Tnks1bp1 T C 2: 85,062,866 S1046P probably benign Het
Ttc27 T G 17: 74,770,264 F385V possibly damaging Het
Ttn C A 2: 76,944,345 G2164W unknown Het
Ubap1 T A 4: 41,379,764 L326* probably null Het
Ubr4 A G 4: 139,426,785 N812S probably damaging Het
Vmn1r160 A G 7: 22,871,353 T44A possibly damaging Het
Vmn1r28 G A 6: 58,265,589 S139N possibly damaging Het
Vmn2r116 A G 17: 23,386,125 I137M probably benign Het
Vmn2r67 A T 7: 85,155,878 W9R probably null Het
Zfp101 T C 17: 33,386,700 N45D possibly damaging Het
Other mutations in Stk36
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00325:Stk36 APN 1 74634702 missense possibly damaging 0.82
IGL00485:Stk36 APN 1 74634085 missense probably benign
IGL00792:Stk36 APN 1 74611117 missense probably benign 0.01
IGL00941:Stk36 APN 1 74623934 missense possibly damaging 0.85
IGL01324:Stk36 APN 1 74625610 missense possibly damaging 0.66
IGL01538:Stk36 APN 1 74633638 missense probably benign 0.03
IGL02143:Stk36 APN 1 74616569 splice site probably benign
IGL02223:Stk36 APN 1 74623337 missense possibly damaging 0.84
IGL02371:Stk36 APN 1 74622255 missense probably benign 0.13
IGL02618:Stk36 APN 1 74631675 splice site probably benign
IGL02655:Stk36 APN 1 74634535 missense probably damaging 1.00
IGL02993:Stk36 APN 1 74622287 missense probably benign 0.05
IGL03125:Stk36 APN 1 74623313 missense probably damaging 1.00
IGL03242:Stk36 APN 1 74623352 missense possibly damaging 0.70
R0373:Stk36 UTSW 1 74633620 missense probably damaging 0.99
R0377:Stk36 UTSW 1 74612730 missense probably benign
R0464:Stk36 UTSW 1 74611172 missense probably damaging 0.98
R0520:Stk36 UTSW 1 74602206 unclassified probably benign
R0551:Stk36 UTSW 1 74616621 missense probably benign 0.00
R1118:Stk36 UTSW 1 74632766 missense probably benign 0.29
R1119:Stk36 UTSW 1 74632766 missense probably benign 0.29
R1471:Stk36 UTSW 1 74611155 missense probably benign 0.14
R1915:Stk36 UTSW 1 74634187 missense probably benign 0.08
R2159:Stk36 UTSW 1 74634737 missense probably benign 0.00
R2290:Stk36 UTSW 1 74626144 splice site probably benign
R2897:Stk36 UTSW 1 74632825 missense probably null
R2898:Stk36 UTSW 1 74632825 missense probably null
R4032:Stk36 UTSW 1 74626048 missense probably benign
R4353:Stk36 UTSW 1 74632807 missense possibly damaging 0.53
R4683:Stk36 UTSW 1 74634185 missense probably benign 0.22
R4753:Stk36 UTSW 1 74626096 missense probably benign 0.05
R4891:Stk36 UTSW 1 74603256 missense probably damaging 1.00
R5068:Stk36 UTSW 1 74622345 missense probably benign 0.00
R5115:Stk36 UTSW 1 74635827 missense probably damaging 1.00
R5266:Stk36 UTSW 1 74611158 missense probably benign
R5412:Stk36 UTSW 1 74605456 unclassified probably null
R5533:Stk36 UTSW 1 74626591 missense possibly damaging 0.65
R5782:Stk36 UTSW 1 74605425 missense possibly damaging 0.81
R6149:Stk36 UTSW 1 74634229 missense probably benign 0.00
R6208:Stk36 UTSW 1 74611432 missense probably benign 0.03
R6497:Stk36 UTSW 1 74603232 missense probably damaging 1.00
R6805:Stk36 UTSW 1 74622239 missense probably benign
R7064:Stk36 UTSW 1 74610820 missense probably damaging 1.00
R7102:Stk36 UTSW 1 74622223 missense probably benign 0.10
R7408:Stk36 UTSW 1 74633566 missense probably damaging 1.00
R7471:Stk36 UTSW 1 74634320 missense unknown
R7816:Stk36 UTSW 1 74611169 nonsense probably null
Predicted Primers PCR Primer
(F):5'- AATGGCCTCTTCCTACGGAG -3'
(R):5'- CGGAGACAAGAGAACTATTTGTGC -3'

Sequencing Primer
(F):5'- AGAGCCACTGATGTGTCCCTTG -3'
(R):5'- ATTTGTGCTCTTCCTATCTTTTTGC -3'
Posted On2019-09-13