Mutagenetix > Incidental Mutations

Incidental Mutation 'R7393:Dsel'

573568

Institutional Source

Beutler Lab

Gene Symbol

Dsel

Ensembl Gene

ENSMUSG00000038702

Gene Name

dermatan sulfate epimerase-like

Synonyms

9330132E09Rik, DS-epi2

MMRRC Submission

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.103) question?

Stock #

R7393 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

111858702-111864918 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 111861573 bp

Zygosity

Heterozygous

Amino Acid Change

Glycine to Serine at position 411 (G411S)

Ref Sequence

ENSEMBL: ENSMUSP00000043570 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000035462]

Predicted Effect

probably damaging
Transcript: ENSMUST00000035462
AA Change: G411S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000043570
Gene: ENSMUSG00000038702
AA Change: G411S

Domain	Start	End	E-Value	Type
signal peptide	1	22	N/A	INTRINSIC
low complexity region	120	131	N/A	INTRINSIC
low complexity region	568	577	N/A	INTRINSIC
transmembrane domain	769	791	N/A	INTRINSIC
transmembrane domain	798	817	N/A	INTRINSIC
Pfam:Sulfotransfer_1	847	1201	2.1e-12	PFAM
Pfam:Sulfotransfer_3	848	1143	1.7e-11	PFAM

Meta Mutation Damage Score

0.5608

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 99.1%

Validation Efficiency

MGI Phenotype

PHENOTYPE: Mice homozygous for a knock-out allele exhibit reduced epimerase activity in the skin, lung, liver, spleen, kidney and brain and reduced iduronic acid content in the brain and kidney chondroitin sulfate/dermatan sulfate. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 69 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2010107E04Rik	A	G	12: 111,963,277	V26A	probably benign	Het
Abcb11	C	T	2: 69,299,867	D282N	probably damaging	Het
Abi2	T	C	1: 60,434,382	M86T	possibly damaging	Het
Adam26a	T	C	8: 43,569,688	N255S	probably benign	Het
Adam4	G	A	12: 81,419,660	S729L	probably benign	Het
Adcy1	G	T	11: 7,137,381	W418C	probably damaging	Het
Add2	T	A	6: 86,098,647	Y259*	probably null	Het
Agl	A	T	3: 116,791,156	C172S	probably benign	Het
Ankfy1	A	G	11: 72,738,308	T319A	possibly damaging	Het
Armc8	A	T	9: 99,483,999	C621S	possibly damaging	Het
Bbc3	A	G	7: 16,313,789	D146G	probably benign	Het
Btnl10	T	C	11: 58,923,706	L404P	probably damaging	Het
Cbl	A	G	9: 44,154,188		probably null	Het
Ccdc170	T	A	10: 4,514,314		probably null	Het
Ccdc91	T	A	6: 147,534,029	V37E	possibly damaging	Het
Ces1e	G	T	8: 93,210,417	T343K	probably benign	Het
Chfr	T	A	5: 110,152,358	F323I	probably damaging	Het
Clcnkb	T	A	4: 141,409,445	M370L	probably benign	Het
Col11a1	A	G	3: 114,097,106	D364G	unknown	Het
Ctbp2	A	G	7: 132,988,292	I381T	probably benign	Het
Cyp4a29	A	C	4: 115,242,196	Y38S	probably damaging	Het
Ddx1	T	C	12: 13,230,353	D382G	probably benign	Het
Dhx57	T	A	17: 80,255,571	N876Y	probably damaging	Het
Enpp5	G	A	17: 44,085,264	G356S	probably damaging	Het
Fam234a	T	C	17: 26,216,624	D262G	probably benign	Het
Fnbp4	C	A	2: 90,779,316	Q1035K	probably damaging	Het
Gbp11	T	A	5: 105,327,577	N302Y	possibly damaging	Het
Gm11554	T	A	11: 99,803,872	T172S	unknown	Het
Hamp2	A	T	7: 30,922,605	M53K	possibly damaging	Het
Kcnj1	A	G	9: 32,397,018	D246G	probably damaging	Het
Kctd20	T	C	17: 28,963,338	F209L	probably damaging	Het
Klra2	T	C	6: 131,230,202	Y148C	probably damaging	Het
Krtap15	T	C	16: 88,829,097		probably null	Het
Mrps23	T	C	11: 88,204,458	L6P	probably damaging	Het
Ms4a6d	G	A	19: 11,590,073	Q155*	probably null	Het
Myo7a	G	A	7: 98,063,699	R1690C	possibly damaging	Het
Nbas	T	C	12: 13,393,492	S1183P	probably damaging	Het
Ndufaf4	T	A	4: 24,903,177	M122K	probably benign	Het
Nop2	C	A	6: 125,133,546	S45*	probably null	Het
Nop56	T	A	2: 130,274,638	L3Q	probably benign	Het
Nrp2	T	C	1: 62,745,424	I244T	probably damaging	Het
Olfr1426	T	A	19: 12,088,628	T55S	probably benign	Het
Olfr620	A	G	7: 103,611,991	S121P	possibly damaging	Het
Otof	T	C	5: 30,370,270	D1941G	probably benign	Het
Pcyox1l	T	C	18: 61,697,641	K387E	probably benign	Het
Plcg2	A	G	8: 117,579,825	Y306C	possibly damaging	Het
Ppp1r13b	G	A	12: 111,838,754	P333S	probably damaging	Het
Rcc2	A	G	4: 140,717,030	D344G	probably damaging	Het
Reln	A	T	5: 21,976,351	N1810K	probably damaging	Het
Rfesd	G	T	13: 76,003,030	A90E	probably benign	Het
Rsf1	CGGCGGCGG	CGGCGGCGGGGGCGGCGG	7: 97,579,917		probably benign	Het
Scg2	T	C	1: 79,435,231	K552E	probably damaging	Het
Sdccag8	A	G	1: 176,840,306	I190V	probably benign	Het
Sele	C	A	1: 164,053,923	T533K	probably benign	Het
Sh3bp4	T	A	1: 89,144,448	H339Q	possibly damaging	Het
Slc6a19	A	G	13: 73,692,974	S106P	probably benign	Het
Spidr	C	T	16: 16,146,831		probably benign	Het
Stk36	A	T	1: 74,611,193	K295*	probably null	Het
Synj1	A	T	16: 90,951,999	D1056E	probably damaging	Het
Tnks1bp1	T	C	2: 85,062,866	S1046P	probably benign	Het
Ttc27	T	G	17: 74,770,264	F385V	possibly damaging	Het
Ttn	C	A	2: 76,944,345	G2164W	unknown	Het
Ubap1	T	A	4: 41,379,764	L326*	probably null	Het
Ubr4	A	G	4: 139,426,785	N812S	probably damaging	Het
Vmn1r160	A	G	7: 22,871,353	T44A	possibly damaging	Het
Vmn1r28	G	A	6: 58,265,589	S139N	possibly damaging	Het
Vmn2r116	A	G	17: 23,386,125	I137M	probably benign	Het
Vmn2r67	A	T	7: 85,155,878	W9R	probably null	Het
Zfp101	T	C	17: 33,386,700	N45D	possibly damaging	Het

Other mutations in Dsel

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01114:Dsel	APN	1	111860061	nonsense	probably null
IGL01562:Dsel	APN	1	111860319	missense	probably benign
IGL01591:Dsel	APN	1	111859695	missense	probably benign	0.08
IGL01822:Dsel	APN	1	111861896	missense	probably damaging	1.00
IGL02289:Dsel	APN	1	111860102	nonsense	probably null
IGL02557:Dsel	APN	1	111862570	missense	probably damaging	1.00
IGL02805:Dsel	APN	1	111862316	missense	probably damaging	1.00
IGL02864:Dsel	APN	1	111859214	missense	probably damaging	1.00
IGL02887:Dsel	APN	1	111860732	missense	possibly damaging	0.90
IGL03092:Dsel	APN	1	111860063	missense	probably damaging	1.00
IGL03117:Dsel	APN	1	111859178	utr 3 prime	probably benign
IGL03182:Dsel	APN	1	111860138	missense	probably damaging	0.99
rudolph	UTSW	1	111859817	missense	probably damaging	0.99
R0196:Dsel	UTSW	1	111861603	missense	possibly damaging	0.86
R0465:Dsel	UTSW	1	111862262	missense	probably benign	0.00
R0725:Dsel	UTSW	1	111859952	missense	possibly damaging	0.79
R1024:Dsel	UTSW	1	111860673	missense	probably damaging	1.00
R1147:Dsel	UTSW	1	111862209	missense	possibly damaging	0.71
R1147:Dsel	UTSW	1	111862209	missense	possibly damaging	0.71
R1654:Dsel	UTSW	1	111862512	missense	probably damaging	1.00
R1728:Dsel	UTSW	1	111859457	missense	probably benign
R1728:Dsel	UTSW	1	111859994	missense	probably benign
R1729:Dsel	UTSW	1	111859457	missense	probably benign
R1729:Dsel	UTSW	1	111859994	missense	probably benign
R1730:Dsel	UTSW	1	111859457	missense	probably benign
R1730:Dsel	UTSW	1	111859994	missense	probably benign
R1735:Dsel	UTSW	1	111860915	missense	probably damaging	1.00
R1739:Dsel	UTSW	1	111859457	missense	probably benign
R1739:Dsel	UTSW	1	111859994	missense	probably benign
R1762:Dsel	UTSW	1	111859457	missense	probably benign
R1762:Dsel	UTSW	1	111859994	missense	probably benign
R1783:Dsel	UTSW	1	111859457	missense	probably benign
R1783:Dsel	UTSW	1	111859994	missense	probably benign
R1785:Dsel	UTSW	1	111859457	missense	probably benign
R1785:Dsel	UTSW	1	111859994	missense	probably benign
R2049:Dsel	UTSW	1	111859457	missense	probably benign
R2080:Dsel	UTSW	1	111859962	missense	probably benign
R2141:Dsel	UTSW	1	111859457	missense	probably benign
R2142:Dsel	UTSW	1	111859457	missense	probably benign
R2150:Dsel	UTSW	1	111860257	missense	probably benign	0.04
R4324:Dsel	UTSW	1	111861393	missense	probably damaging	1.00
R5378:Dsel	UTSW	1	111862821	start gained	probably benign
R5881:Dsel	UTSW	1	111859438	missense	probably damaging	1.00
R5919:Dsel	UTSW	1	111860253	missense	probably benign
R6820:Dsel	UTSW	1	111859817	missense	probably damaging	0.99
R7003:Dsel	UTSW	1	111860295	missense	probably benign
R7064:Dsel	UTSW	1	111862847	start gained	probably benign
R7297:Dsel	UTSW	1	111861776	missense	probably damaging	1.00
R7340:Dsel	UTSW	1	111861573	missense	probably damaging	1.00
R7341:Dsel	UTSW	1	111861573	missense	probably damaging	1.00
R7343:Dsel	UTSW	1	111861573	missense	probably damaging	1.00
R7346:Dsel	UTSW	1	111861068	missense	probably damaging	1.00
R7347:Dsel	UTSW	1	111861573	missense	probably damaging	1.00
R7365:Dsel	UTSW	1	111861573	missense	probably damaging	1.00
R7366:Dsel	UTSW	1	111861573	missense	probably damaging	1.00
R7367:Dsel	UTSW	1	111861573	missense	probably damaging	1.00
R7974:Dsel	UTSW	1	111860499	missense	probably benign	0.00
R7978:Dsel	UTSW	1	111859719	nonsense	probably null
R8220:Dsel	UTSW	1	111861707	missense	probably damaging	1.00
R8434:Dsel	UTSW	1	111861655	missense	probably damaging	1.00
X0057:Dsel	UTSW	1	111859210	missense	probably benign
Z1177:Dsel	UTSW	1	111861716	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CTGCCCATTAGGAGCGAAAG -3'
(R):5'- AGTTCATTTTACAGAATGGAGCTGG -3'

Sequencing Primer
(F):5'- CTGCCCATTAGGAGCGAAAGTAAATG -3'
(R):5'- AGCTGGAAATTGGTTAGCTCAGC -3'

Posted On

2019-09-13