Incidental Mutation 'R7393:Nop56'
ID573575
Institutional Source Beutler Lab
Gene Symbol Nop56
Ensembl Gene ENSMUSG00000027405
Gene NameNOP56 ribonucleoprotein
SynonymsNOP56, Nol5a, 2310044F10Rik, 56kDa with KKE/D repeat
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.965) question?
Stock #R7393 (G1)
Quality Score225.009
Status Not validated
Chromosome2
Chromosomal Location130274430-130279313 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 130274638 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Glutamine at position 3 (L3Q)
Ref Sequence ENSEMBL: ENSMUSP00000099487 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028890] [ENSMUST00000028892] [ENSMUST00000103198] [ENSMUST00000136621] [ENSMUST00000159373] [ENSMUST00000184538]
Predicted Effect probably benign
Transcript: ENSMUST00000028890
SMART Domains Protein: ENSMUSP00000028890
Gene: ENSMUSG00000027405

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:Nop 44 127 1.1e-26 PFAM
coiled coil region 131 176 N/A INTRINSIC
low complexity region 185 204 N/A INTRINSIC
low complexity region 213 228 N/A INTRINSIC
low complexity region 242 264 N/A INTRINSIC
low complexity region 280 292 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000028892
SMART Domains Protein: ENSMUSP00000028892
Gene: ENSMUSG00000027406

DomainStartEndE-ValueType
low complexity region 28 40 N/A INTRINSIC
Iso_dh 49 375 1.43e-140 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000103198
AA Change: L3Q

PolyPhen 2 Score 0.058 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000099487
Gene: ENSMUSG00000027405
AA Change: L3Q

DomainStartEndE-ValueType
Pfam:NOP5NT 5 70 4.3e-20 PFAM
NOSIC 167 219 1.18e-30 SMART
internal_repeat_1 257 305 4.06e-5 PROSPERO
coiled coil region 415 460 N/A INTRINSIC
low complexity region 469 488 N/A INTRINSIC
low complexity region 497 512 N/A INTRINSIC
low complexity region 526 548 N/A INTRINSIC
low complexity region 564 576 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000136621
AA Change: L3Q

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000124616
Gene: ENSMUSG00000027405
AA Change: L3Q

DomainStartEndE-ValueType
Pfam:NOP5NT 4 70 3.6e-22 PFAM
NOSIC 167 219 1.18e-30 SMART
Predicted Effect
SMART Domains Protein: ENSMUSP00000125305
Gene: ENSMUSG00000027405
AA Change: L11Q

DomainStartEndE-ValueType
Pfam:NOP5NT 14 79 3.8e-22 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000143547
Predicted Effect probably benign
Transcript: ENSMUST00000146454
SMART Domains Protein: ENSMUSP00000125304
Gene: ENSMUSG00000027405

DomainStartEndE-ValueType
Pfam:Nop 1 152 7.8e-66 PFAM
coiled coil region 159 204 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000149955
SMART Domains Protein: ENSMUSP00000123879
Gene: ENSMUSG00000027405

DomainStartEndE-ValueType
NOSIC 2 35 1.24e-6 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000150401
SMART Domains Protein: ENSMUSP00000123890
Gene: ENSMUSG00000027405

DomainStartEndE-ValueType
Pfam:Nop 26 103 3.9e-26 PFAM
coiled coil region 110 155 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000159373
SMART Domains Protein: ENSMUSP00000124080
Gene: ENSMUSG00000027405

DomainStartEndE-ValueType
Pfam:Nop 10 94 6e-28 PFAM
coiled coil region 98 135 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000184538
SMART Domains Protein: ENSMUSP00000139331
Gene: ENSMUSG00000027406

DomainStartEndE-ValueType
Pfam:Iso_dh 6 71 1.8e-15 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Nop56p is a yeast nucleolar protein that is part of a complex with the nucleolar proteins Nop58p and fibrillarin. Nop56p is required for assembly of the 60S ribosomal subunit and is involved in pre-rRNA processing. The protein encoded by this gene is similar in sequence to Nop56p and is also found in the nucleolus. Expansion of a GGCCTG repeat from 3-8 copies to 1500-2500 copies in an intron of this gene results in spinocerebellar ataxia 36. Multiple transcript variants encoding several different isoforms have been found for this gene, but the full-length nature of most of them has not been determined. [provided by RefSeq, Jul 2016]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010107E04Rik A G 12: 111,963,277 V26A probably benign Het
Abcb11 C T 2: 69,299,867 D282N probably damaging Het
Abi2 T C 1: 60,434,382 M86T possibly damaging Het
Adam26a T C 8: 43,569,688 N255S probably benign Het
Adam4 G A 12: 81,419,660 S729L probably benign Het
Adcy1 G T 11: 7,137,381 W418C probably damaging Het
Add2 T A 6: 86,098,647 Y259* probably null Het
Agl A T 3: 116,791,156 C172S probably benign Het
Ankfy1 A G 11: 72,738,308 T319A possibly damaging Het
Armc8 A T 9: 99,483,999 C621S possibly damaging Het
Bbc3 A G 7: 16,313,789 D146G probably benign Het
Btnl10 T C 11: 58,923,706 L404P probably damaging Het
Cbl A G 9: 44,154,188 probably null Het
Ccdc170 T A 10: 4,514,314 probably null Het
Ccdc91 T A 6: 147,534,029 V37E possibly damaging Het
Ces1e G T 8: 93,210,417 T343K probably benign Het
Chfr T A 5: 110,152,358 F323I probably damaging Het
Clcnkb T A 4: 141,409,445 M370L probably benign Het
Col11a1 A G 3: 114,097,106 D364G unknown Het
Ctbp2 A G 7: 132,988,292 I381T probably benign Het
Cyp4a29 A C 4: 115,242,196 Y38S probably damaging Het
Ddx1 T C 12: 13,230,353 D382G probably benign Het
Dhx57 T A 17: 80,255,571 N876Y probably damaging Het
Dsel C T 1: 111,861,573 G411S probably damaging Het
Enpp5 G A 17: 44,085,264 G356S probably damaging Het
Fam234a T C 17: 26,216,624 D262G probably benign Het
Fnbp4 C A 2: 90,779,316 Q1035K probably damaging Het
Gbp11 T A 5: 105,327,577 N302Y possibly damaging Het
Gm11554 T A 11: 99,803,872 T172S unknown Het
Hamp2 A T 7: 30,922,605 M53K possibly damaging Het
Kcnj1 A G 9: 32,397,018 D246G probably damaging Het
Kctd20 T C 17: 28,963,338 F209L probably damaging Het
Klra2 T C 6: 131,230,202 Y148C probably damaging Het
Krtap15 T C 16: 88,829,097 probably null Het
Mrps23 T C 11: 88,204,458 L6P probably damaging Het
Ms4a6d G A 19: 11,590,073 Q155* probably null Het
Myo7a G A 7: 98,063,699 R1690C possibly damaging Het
Nbas T C 12: 13,393,492 S1183P probably damaging Het
Ndufaf4 T A 4: 24,903,177 M122K probably benign Het
Nop2 C A 6: 125,133,546 S45* probably null Het
Nrp2 T C 1: 62,745,424 I244T probably damaging Het
Olfr1426 T A 19: 12,088,628 T55S probably benign Het
Olfr620 A G 7: 103,611,991 S121P possibly damaging Het
Otof T C 5: 30,370,270 D1941G probably benign Het
Pcyox1l T C 18: 61,697,641 K387E probably benign Het
Plcg2 A G 8: 117,579,825 Y306C possibly damaging Het
Ppp1r13b G A 12: 111,838,754 P333S probably damaging Het
Rcc2 A G 4: 140,717,030 D344G probably damaging Het
Reln A T 5: 21,976,351 N1810K probably damaging Het
Rfesd G T 13: 76,003,030 A90E probably benign Het
Rsf1 CGGCGGCGG CGGCGGCGGGGGCGGCGG 7: 97,579,917 probably benign Het
Scg2 T C 1: 79,435,231 K552E probably damaging Het
Sdccag8 A G 1: 176,840,306 I190V probably benign Het
Sele C A 1: 164,053,923 T533K probably benign Het
Sh3bp4 T A 1: 89,144,448 H339Q possibly damaging Het
Slc6a19 A G 13: 73,692,974 S106P probably benign Het
Spidr C T 16: 16,146,831 probably benign Het
Stk36 A T 1: 74,611,193 K295* probably null Het
Synj1 A T 16: 90,951,999 D1056E probably damaging Het
Tnks1bp1 T C 2: 85,062,866 S1046P probably benign Het
Ttc27 T G 17: 74,770,264 F385V possibly damaging Het
Ttn C A 2: 76,944,345 G2164W unknown Het
Ubap1 T A 4: 41,379,764 L326* probably null Het
Ubr4 A G 4: 139,426,785 N812S probably damaging Het
Vmn1r160 A G 7: 22,871,353 T44A possibly damaging Het
Vmn1r28 G A 6: 58,265,589 S139N possibly damaging Het
Vmn2r116 A G 17: 23,386,125 I137M probably benign Het
Vmn2r67 A T 7: 85,155,878 W9R probably null Het
Zfp101 T C 17: 33,386,700 N45D possibly damaging Het
Other mutations in Nop56
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00834:Nop56 APN 2 130275995 missense possibly damaging 0.77
IGL02330:Nop56 APN 2 130276766 missense probably damaging 0.99
IGL02939:Nop56 APN 2 130278197 missense probably damaging 1.00
IGL03149:Nop56 APN 2 130277525 missense probably damaging 1.00
bookish UTSW 2 130276772 missense possibly damaging 0.96
escholar UTSW 2 130277887 missense probably damaging 1.00
scholar UTSW 2 130275982 missense probably damaging 1.00
IGL03046:Nop56 UTSW 2 130275569 unclassified probably benign
R0421:Nop56 UTSW 2 130276772 missense possibly damaging 0.96
R1405:Nop56 UTSW 2 130277948 missense probably benign 0.22
R1405:Nop56 UTSW 2 130277948 missense probably benign 0.22
R1713:Nop56 UTSW 2 130277966 missense possibly damaging 0.85
R2202:Nop56 UTSW 2 130277568 missense probably damaging 1.00
R2203:Nop56 UTSW 2 130277568 missense probably damaging 1.00
R2204:Nop56 UTSW 2 130277568 missense probably damaging 1.00
R3697:Nop56 UTSW 2 130277587 missense probably damaging 1.00
R4114:Nop56 UTSW 2 130276673 unclassified probably null
R4679:Nop56 UTSW 2 130278273 missense probably benign 0.36
R4788:Nop56 UTSW 2 130278900 missense probably benign 0.05
R4792:Nop56 UTSW 2 130277864 missense possibly damaging 0.96
R4999:Nop56 UTSW 2 130275725 missense probably benign 0.00
R5889:Nop56 UTSW 2 130275982 missense probably damaging 1.00
R6016:Nop56 UTSW 2 130276625 critical splice donor site probably null
R6389:Nop56 UTSW 2 130277887 missense probably damaging 1.00
R7025:Nop56 UTSW 2 130277881 nonsense probably null
R7867:Nop56 UTSW 2 130278285 missense possibly damaging 0.53
R7950:Nop56 UTSW 2 130278285 missense possibly damaging 0.53
R8026:Nop56 UTSW 2 130277268 missense probably benign
Predicted Primers PCR Primer
(F):5'- CTCTGATTGGTCAAACCGGAG -3'
(R):5'- AAGAGTCCCCTCATTCTAGAGC -3'

Sequencing Primer
(F):5'- AAGGTGTGGTCTCCGCAGTC -3'
(R):5'- CCCTCATTCTAGAGCTCCCC -3'
Posted On2019-09-13