Incidental Mutation 'R7393:Ndufaf4'
ID573578
Institutional Source Beutler Lab
Gene Symbol Ndufaf4
Ensembl Gene ENSMUSG00000028261
Gene NameNADH dehydrogenase (ubiquinone) 1 alpha subcomplex, assembly factor 4
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.129) question?
Stock #R7393 (G1)
Quality Score225.009
Status Not validated
Chromosome4
Chromosomal Location24898083-24905001 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 24903177 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 122 (M122K)
Ref Sequence ENSEMBL: ENSMUSP00000117141 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029925] [ENSMUST00000151249]
Predicted Effect probably benign
Transcript: ENSMUST00000029925
SMART Domains Protein: ENSMUSP00000029925
Gene: ENSMUSG00000028261

DomainStartEndE-ValueType
Pfam:UPF0240 1 169 6.4e-67 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000151249
AA Change: M122K

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000117141
Gene: ENSMUSG00000028261
AA Change: M122K

DomainStartEndE-ValueType
Pfam:UPF0240 1 116 2.4e-38 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] NADH:ubiquinone oxidoreductase (complex I) catalyzes the transfer of electrons from NADH to ubiquinone (coenzyme Q) in the first step of the mitochondrial respiratory chain, resulting in the translocation of protons across the inner mitochondrial membrane. This gene encodes a complex I assembly factor. Mutations in this gene are a cause of mitochondrial complex I deficiency. [provided by RefSeq, Oct 2009]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010107E04Rik A G 12: 111,963,277 V26A probably benign Het
Abcb11 C T 2: 69,299,867 D282N probably damaging Het
Abi2 T C 1: 60,434,382 M86T possibly damaging Het
Adam26a T C 8: 43,569,688 N255S probably benign Het
Adam4 G A 12: 81,419,660 S729L probably benign Het
Adcy1 G T 11: 7,137,381 W418C probably damaging Het
Add2 T A 6: 86,098,647 Y259* probably null Het
Agl A T 3: 116,791,156 C172S probably benign Het
Ankfy1 A G 11: 72,738,308 T319A possibly damaging Het
Armc8 A T 9: 99,483,999 C621S possibly damaging Het
Bbc3 A G 7: 16,313,789 D146G probably benign Het
Btnl10 T C 11: 58,923,706 L404P probably damaging Het
Cbl A G 9: 44,154,188 probably null Het
Ccdc170 T A 10: 4,514,314 probably null Het
Ccdc91 T A 6: 147,534,029 V37E possibly damaging Het
Ces1e G T 8: 93,210,417 T343K probably benign Het
Chfr T A 5: 110,152,358 F323I probably damaging Het
Clcnkb T A 4: 141,409,445 M370L probably benign Het
Col11a1 A G 3: 114,097,106 D364G unknown Het
Ctbp2 A G 7: 132,988,292 I381T probably benign Het
Cyp4a29 A C 4: 115,242,196 Y38S probably damaging Het
Ddx1 T C 12: 13,230,353 D382G probably benign Het
Dhx57 T A 17: 80,255,571 N876Y probably damaging Het
Dsel C T 1: 111,861,573 G411S probably damaging Het
Enpp5 G A 17: 44,085,264 G356S probably damaging Het
Fam234a T C 17: 26,216,624 D262G probably benign Het
Fnbp4 C A 2: 90,779,316 Q1035K probably damaging Het
Gbp11 T A 5: 105,327,577 N302Y possibly damaging Het
Gm11554 T A 11: 99,803,872 T172S unknown Het
Hamp2 A T 7: 30,922,605 M53K possibly damaging Het
Kcnj1 A G 9: 32,397,018 D246G probably damaging Het
Kctd20 T C 17: 28,963,338 F209L probably damaging Het
Klra2 T C 6: 131,230,202 Y148C probably damaging Het
Krtap15 T C 16: 88,829,097 probably null Het
Mrps23 T C 11: 88,204,458 L6P probably damaging Het
Ms4a6d G A 19: 11,590,073 Q155* probably null Het
Myo7a G A 7: 98,063,699 R1690C possibly damaging Het
Nbas T C 12: 13,393,492 S1183P probably damaging Het
Nop2 C A 6: 125,133,546 S45* probably null Het
Nop56 T A 2: 130,274,638 L3Q probably benign Het
Nrp2 T C 1: 62,745,424 I244T probably damaging Het
Olfr1426 T A 19: 12,088,628 T55S probably benign Het
Olfr620 A G 7: 103,611,991 S121P possibly damaging Het
Otof T C 5: 30,370,270 D1941G probably benign Het
Pcyox1l T C 18: 61,697,641 K387E probably benign Het
Plcg2 A G 8: 117,579,825 Y306C possibly damaging Het
Ppp1r13b G A 12: 111,838,754 P333S probably damaging Het
Rcc2 A G 4: 140,717,030 D344G probably damaging Het
Reln A T 5: 21,976,351 N1810K probably damaging Het
Rfesd G T 13: 76,003,030 A90E probably benign Het
Rsf1 CGGCGGCGG CGGCGGCGGGGGCGGCGG 7: 97,579,917 probably benign Het
Scg2 T C 1: 79,435,231 K552E probably damaging Het
Sdccag8 A G 1: 176,840,306 I190V probably benign Het
Sele C A 1: 164,053,923 T533K probably benign Het
Sh3bp4 T A 1: 89,144,448 H339Q possibly damaging Het
Slc6a19 A G 13: 73,692,974 S106P probably benign Het
Spidr C T 16: 16,146,831 probably benign Het
Stk36 A T 1: 74,611,193 K295* probably null Het
Synj1 A T 16: 90,951,999 D1056E probably damaging Het
Tnks1bp1 T C 2: 85,062,866 S1046P probably benign Het
Ttc27 T G 17: 74,770,264 F385V possibly damaging Het
Ttn C A 2: 76,944,345 G2164W unknown Het
Ubap1 T A 4: 41,379,764 L326* probably null Het
Ubr4 A G 4: 139,426,785 N812S probably damaging Het
Vmn1r160 A G 7: 22,871,353 T44A possibly damaging Het
Vmn1r28 G A 6: 58,265,589 S139N possibly damaging Het
Vmn2r116 A G 17: 23,386,125 I137M probably benign Het
Vmn2r67 A T 7: 85,155,878 W9R probably null Het
Zfp101 T C 17: 33,386,700 N45D possibly damaging Het
Other mutations in Ndufaf4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03001:Ndufaf4 APN 4 24901747 missense probably benign 0.44
R2128:Ndufaf4 UTSW 4 24898608 missense probably damaging 1.00
R2129:Ndufaf4 UTSW 4 24898608 missense probably damaging 1.00
R5666:Ndufaf4 UTSW 4 24898636 missense probably damaging 1.00
R5670:Ndufaf4 UTSW 4 24898636 missense probably damaging 1.00
R6021:Ndufaf4 UTSW 4 24901760 missense probably benign 0.02
R7519:Ndufaf4 UTSW 4 24901847 missense probably damaging 0.99
R7586:Ndufaf4 UTSW 4 24901829 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- AATGGGTGTCTACAAAACACAC -3'
(R):5'- GGCACTTTCCACCATAATCAGC -3'

Sequencing Primer
(F):5'- CCTGTAGTTTATGATGCAAGGAAGCC -3'
(R):5'- GCAATGATTGGAATTAGTAGGTTCCC -3'
Posted On2019-09-13