Mutagenetix > Incidental Mutation

Incidental Mutation 'R7393:Ubr4'

573581

Institutional Source

Beutler Lab

Gene Symbol

Ubr4

Ensembl Gene

ENSMUSG00000066036

Gene Name

ubiquitin protein ligase E3 component n-recognin 4

Synonyms

p600, A930005E13Rik, LOC381562, D930005K06Rik, Zubr1, 1810009A16Rik

MMRRC Submission

045475-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R7393 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

139107970-139216844 bp(+) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 139154096 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Serine at position 812 (N812S)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000097822] [ENSMUST00000147999] [ENSMUST00000165860]

AlphaFold

no structure available at present

Predicted Effect

possibly damaging
Transcript: ENSMUST00000097822
AA Change: N2101S

PolyPhen 2 Score 0.891 (Sensitivity: 0.82; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000095433
Gene: ENSMUSG00000066036
AA Change: N2101S

Domain	Start	End	E-Value	Type
low complexity region	5	20	N/A	INTRINSIC
low complexity region	414	425	N/A	INTRINSIC
low complexity region	530	541	N/A	INTRINSIC
low complexity region	555	566	N/A	INTRINSIC
low complexity region	571	588	N/A	INTRINSIC
low complexity region	600	621	N/A	INTRINSIC
low complexity region	1312	1330	N/A	INTRINSIC
low complexity region	1642	1655	N/A	INTRINSIC
Pfam:zf-UBR	1660	1725	1.9e-9	PFAM
Blast:ZnF_C2H2	1966	1991	6e-8	BLAST
low complexity region	2268	2279	N/A	INTRINSIC
low complexity region	2502	2540	N/A	INTRINSIC
low complexity region	2725	2735	N/A	INTRINSIC
low complexity region	2818	2852	N/A	INTRINSIC
low complexity region	2887	2905	N/A	INTRINSIC
low complexity region	2928	2942	N/A	INTRINSIC
low complexity region	2945	2959	N/A	INTRINSIC
low complexity region	2966	2986	N/A	INTRINSIC
low complexity region	3063	3091	N/A	INTRINSIC
low complexity region	3329	3385	N/A	INTRINSIC
low complexity region	3776	3788	N/A	INTRINSIC
Pfam:E3_UbLigase_R4	4364	5160	N/A	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000129949
AA Change: N812S

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000115711
Gene: ENSMUSG00000066036
AA Change: N812S

Domain	Start	End	E-Value	Type
low complexity region	24	42	N/A	INTRINSIC
low complexity region	354	367	N/A	INTRINSIC
Pfam:zf-UBR	372	437	2.1e-10	PFAM
Blast:ZnF_C2H2	678	703	5e-8	BLAST
low complexity region	980	991	N/A	INTRINSIC
low complexity region	1225	1263	N/A	INTRINSIC
low complexity region	1448	1458	N/A	INTRINSIC
low complexity region	1575	1593	N/A	INTRINSIC
low complexity region	1616	1630	N/A	INTRINSIC
low complexity region	1633	1647	N/A	INTRINSIC
low complexity region	1654	1674	N/A	INTRINSIC
low complexity region	1751	1779	N/A	INTRINSIC
low complexity region	2017	2045	N/A	INTRINSIC
low complexity region	2048	2065	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000147999

SMART Domains

Protein: ENSMUSP00000117419
Gene: ENSMUSG00000066036

Domain	Start	End	E-Value	Type
low complexity region	170	226	N/A	INTRINSIC
low complexity region	617	629	N/A	INTRINSIC
Pfam:E3_UbLigase_R4	1205	1301	4.5e-60	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000165860
AA Change: N2101S

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000125800
Gene: ENSMUSG00000066036
AA Change: N2101S

Domain	Start	End	E-Value	Type
low complexity region	5	20	N/A	INTRINSIC
low complexity region	414	425	N/A	INTRINSIC
low complexity region	530	541	N/A	INTRINSIC
low complexity region	555	566	N/A	INTRINSIC
low complexity region	571	588	N/A	INTRINSIC
low complexity region	600	621	N/A	INTRINSIC
low complexity region	1312	1330	N/A	INTRINSIC
low complexity region	1642	1655	N/A	INTRINSIC
Pfam:zf-UBR	1659	1729	4e-13	PFAM
Blast:ZnF_C2H2	1966	1991	5e-8	BLAST
low complexity region	2268	2279	N/A	INTRINSIC
low complexity region	2513	2551	N/A	INTRINSIC
low complexity region	2736	2746	N/A	INTRINSIC
low complexity region	2863	2881	N/A	INTRINSIC
low complexity region	2904	2918	N/A	INTRINSIC
low complexity region	2921	2935	N/A	INTRINSIC
low complexity region	2942	2962	N/A	INTRINSIC
low complexity region	3039	3067	N/A	INTRINSIC
low complexity region	3305	3361	N/A	INTRINSIC
low complexity region	3752	3764	N/A	INTRINSIC
Pfam:E3_UbLigase_R4	4340	5136	N/A	PFAM

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 99.1%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is an E3 ubiquitin-protein ligase that interacts with the retinoblastoma-associated protein in the nucleus and with calcium-bound calmodulin in the cytoplasm. The encoded protein appears to be a cytoskeletal component in the cytoplasm and part of the chromatin scaffold in the nucleus. In addition, this protein is a target of the human papillomavirus type 16 E7 oncoprotein. [provided by RefSeq, Aug 2010]
PHENOTYPE: Mice homozygous for a transgenic gene disruption exhibit neonatal lethality and decreased body size at birth. Mice homozygous for a null mutation display complete embryonic lethality during organogenesis with arrest of vitelline vascular remodeling. [provided by MGI curators]

Allele List at MGI

All alleles(59) : Targeted(2) Gene trapped(56) Transgenic(1)

Other mutations in this stock

Total: 69 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abcb11	C	T	2: 69,130,211 (GRCm39)	D282N	probably damaging	Het
Abi2	T	C	1: 60,473,541 (GRCm39)	M86T	possibly damaging	Het
Adam26a	T	C	8: 44,022,725 (GRCm39)	N255S	probably benign	Het
Adam4	G	A	12: 81,466,434 (GRCm39)	S729L	probably benign	Het
Adcy1	G	T	11: 7,087,381 (GRCm39)	W418C	probably damaging	Het
Add2	T	A	6: 86,075,629 (GRCm39)	Y259*	probably null	Het
Agl	A	T	3: 116,584,805 (GRCm39)	C172S	probably benign	Het
Ankfy1	A	G	11: 72,629,134 (GRCm39)	T319A	possibly damaging	Het
Armc8	A	T	9: 99,366,052 (GRCm39)	C621S	possibly damaging	Het
Atp5mj	A	G	12: 111,929,711 (GRCm39)	V26A	probably benign	Het
Bbc3	A	G	7: 16,047,714 (GRCm39)	D146G	probably benign	Het
Btnl10	T	C	11: 58,814,532 (GRCm39)	L404P	probably damaging	Het
Cbl	A	G	9: 44,065,485 (GRCm39)		probably null	Het
Ccdc170	T	A	10: 4,464,314 (GRCm39)		probably null	Het
Ccdc91	T	A	6: 147,435,527 (GRCm39)	V37E	possibly damaging	Het
Ces1e	G	T	8: 93,937,045 (GRCm39)	T343K	probably benign	Het
Chfr	T	A	5: 110,300,224 (GRCm39)	F323I	probably damaging	Het
Clcnkb	T	A	4: 141,136,756 (GRCm39)	M370L	probably benign	Het
Col11a1	A	G	3: 113,890,755 (GRCm39)	D364G	unknown	Het
Ctbp2	A	G	7: 132,590,021 (GRCm39)	I381T	probably benign	Het
Cyp4a29	A	C	4: 115,099,393 (GRCm39)	Y38S	probably damaging	Het
Ddx1	T	C	12: 13,280,354 (GRCm39)	D382G	probably benign	Het
Dhx57	T	A	17: 80,563,000 (GRCm39)	N876Y	probably damaging	Het
Dsel	C	T	1: 111,789,303 (GRCm39)	G411S	probably damaging	Het
Enpp5	G	A	17: 44,396,155 (GRCm39)	G356S	probably damaging	Het
Fam234a	T	C	17: 26,435,598 (GRCm39)	D262G	probably benign	Het
Fnbp4	C	A	2: 90,609,660 (GRCm39)	Q1035K	probably damaging	Het
Gbp11	T	A	5: 105,475,443 (GRCm39)	N302Y	possibly damaging	Het
Gm11554	T	A	11: 99,694,698 (GRCm39)	T172S	unknown	Het
Hamp2	A	T	7: 30,622,030 (GRCm39)	M53K	possibly damaging	Het
Kcnj1	A	G	9: 32,308,314 (GRCm39)	D246G	probably damaging	Het
Kctd20	T	C	17: 29,182,312 (GRCm39)	F209L	probably damaging	Het
Klra2	T	C	6: 131,207,165 (GRCm39)	Y148C	probably damaging	Het
Krtap15-1	T	C	16: 88,625,985 (GRCm39)		probably null	Het
Mrps23	T	C	11: 88,095,284 (GRCm39)	L6P	probably damaging	Het
Ms4a6d	G	A	19: 11,567,437 (GRCm39)	Q155*	probably null	Het
Myo7a	G	A	7: 97,712,906 (GRCm39)	R1690C	possibly damaging	Het
Nbas	T	C	12: 13,443,493 (GRCm39)	S1183P	probably damaging	Het
Ndufaf4	T	A	4: 24,903,177 (GRCm39)	M122K	probably benign	Het
Nop2	C	A	6: 125,110,509 (GRCm39)	S45*	probably null	Het
Nop56	T	A	2: 130,116,558 (GRCm39)	L3Q	probably benign	Het
Nrp2	T	C	1: 62,784,583 (GRCm39)	I244T	probably damaging	Het
Or4d10c	T	A	19: 12,065,992 (GRCm39)	T55S	probably benign	Het
Or51v14	A	G	7: 103,261,198 (GRCm39)	S121P	possibly damaging	Het
Otof	T	C	5: 30,527,614 (GRCm39)	D1941G	probably benign	Het
Pcyox1l	T	C	18: 61,830,712 (GRCm39)	K387E	probably benign	Het
Plcg2	A	G	8: 118,306,564 (GRCm39)	Y306C	possibly damaging	Het
Ppp1r13b	G	A	12: 111,805,188 (GRCm39)	P333S	probably damaging	Het
Rcc2	A	G	4: 140,444,341 (GRCm39)	D344G	probably damaging	Het
Reln	A	T	5: 22,181,349 (GRCm39)	N1810K	probably damaging	Het
Rfesd	G	T	13: 76,151,149 (GRCm39)	A90E	probably benign	Het
Rsf1	CGGCGGCGG	CGGCGGCGGGGGCGGCGG	7: 97,229,124 (GRCm39)		probably benign	Het
Scg2	T	C	1: 79,412,948 (GRCm39)	K552E	probably damaging	Het
Sdccag8	A	G	1: 176,667,872 (GRCm39)	I190V	probably benign	Het
Sele	C	A	1: 163,881,492 (GRCm39)	T533K	probably benign	Het
Sh3bp4	T	A	1: 89,072,170 (GRCm39)	H339Q	possibly damaging	Het
Slc6a19	A	G	13: 73,841,093 (GRCm39)	S106P	probably benign	Het
Spidr	C	T	16: 15,964,695 (GRCm39)		probably benign	Het
Stk36	A	T	1: 74,650,352 (GRCm39)	K295*	probably null	Het
Synj1	A	T	16: 90,748,887 (GRCm39)	D1056E	probably damaging	Het
Tnks1bp1	T	C	2: 84,893,210 (GRCm39)	S1046P	probably benign	Het
Ttc27	T	G	17: 75,077,259 (GRCm39)	F385V	possibly damaging	Het
Ttn	C	A	2: 76,774,689 (GRCm39)	G2164W	unknown	Het
Ubap1	T	A	4: 41,379,764 (GRCm39)	L326*	probably null	Het
Vmn1r160	A	G	7: 22,570,778 (GRCm39)	T44A	possibly damaging	Het
Vmn1r28	G	A	6: 58,242,574 (GRCm39)	S139N	possibly damaging	Het
Vmn2r116	A	G	17: 23,605,099 (GRCm39)	I137M	probably benign	Het
Vmn2r67	A	T	7: 84,805,086 (GRCm39)	W9R	probably null	Het
Zfp101	T	C	17: 33,605,674 (GRCm39)	N45D	possibly damaging	Het

Other mutations in Ubr4

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00087:Ubr4	APN	4	139,192,633 (GRCm39)	missense	possibly damaging	0.46
IGL00336:Ubr4	APN	4	139,155,877 (GRCm39)	missense	probably damaging	1.00
IGL00586:Ubr4	APN	4	139,182,495 (GRCm39)	missense	possibly damaging	0.95
IGL00659:Ubr4	APN	4	139,148,556 (GRCm39)	missense	probably damaging	1.00
IGL00766:Ubr4	APN	4	139,168,077 (GRCm39)	missense	probably damaging	1.00
IGL00819:Ubr4	APN	4	139,203,593 (GRCm39)	missense	possibly damaging	0.92
IGL00833:Ubr4	APN	4	139,120,470 (GRCm39)	critical splice donor site	probably null
IGL01126:Ubr4	APN	4	139,129,866 (GRCm39)	missense	probably benign	0.04
IGL01311:Ubr4	APN	4	139,206,356 (GRCm39)	missense	possibly damaging	0.66
IGL01349:Ubr4	APN	4	139,208,039 (GRCm39)	missense	unknown
IGL01388:Ubr4	APN	4	139,187,554 (GRCm39)	missense	possibly damaging	0.76
IGL01417:Ubr4	APN	4	139,138,111 (GRCm39)	missense	probably damaging	0.99
IGL01446:Ubr4	APN	4	139,165,351 (GRCm39)	splice site	probably benign
IGL01449:Ubr4	APN	4	139,140,047 (GRCm39)	missense	probably damaging	0.98
IGL01545:Ubr4	APN	4	139,170,140 (GRCm39)	splice site	probably benign
IGL01568:Ubr4	APN	4	139,148,684 (GRCm39)	missense	probably damaging	1.00
IGL01596:Ubr4	APN	4	139,189,845 (GRCm39)	splice site	probably benign
IGL01621:Ubr4	APN	4	139,168,094 (GRCm39)	nonsense	probably null
IGL01639:Ubr4	APN	4	139,144,655 (GRCm39)	missense	probably damaging	0.99
IGL01655:Ubr4	APN	4	139,135,107 (GRCm39)	missense	probably damaging	1.00
IGL01710:Ubr4	APN	4	139,145,772 (GRCm39)	missense	possibly damaging	0.81
IGL01830:Ubr4	APN	4	139,199,811 (GRCm39)	missense	probably damaging	0.99
IGL01862:Ubr4	APN	4	139,204,469 (GRCm39)	missense	possibly damaging	0.66
IGL01868:Ubr4	APN	4	139,139,989 (GRCm39)	nonsense	probably null
IGL01874:Ubr4	APN	4	139,120,600 (GRCm39)	splice site	probably benign
IGL01889:Ubr4	APN	4	139,189,783 (GRCm39)	nonsense	probably null
IGL01891:Ubr4	APN	4	139,163,571 (GRCm39)	critical splice donor site	probably null
IGL01980:Ubr4	APN	4	139,156,913 (GRCm39)	missense	probably damaging	0.99
IGL02126:Ubr4	APN	4	139,180,052 (GRCm39)	critical splice donor site	probably null
IGL02153:Ubr4	APN	4	139,187,471 (GRCm39)	nonsense	probably null
IGL02173:Ubr4	APN	4	139,164,381 (GRCm39)	splice site	probably null
IGL02214:Ubr4	APN	4	139,155,894 (GRCm39)	missense	possibly damaging	0.95
IGL02214:Ubr4	APN	4	139,189,138 (GRCm39)	critical splice acceptor site	probably null
IGL02220:Ubr4	APN	4	139,115,746 (GRCm39)	missense	probably benign	0.01
IGL02246:Ubr4	APN	4	139,186,414 (GRCm39)	missense	possibly damaging	0.89
IGL02264:Ubr4	APN	4	139,182,939 (GRCm39)	nonsense	probably null
IGL02273:Ubr4	APN	4	139,199,889 (GRCm39)	missense	possibly damaging	0.94
IGL02316:Ubr4	APN	4	139,200,489 (GRCm39)	missense	possibly damaging	0.46
IGL02328:Ubr4	APN	4	139,206,233 (GRCm39)	missense	probably damaging	0.97
IGL02476:Ubr4	APN	4	139,148,560 (GRCm39)	nonsense	probably null
IGL02477:Ubr4	APN	4	139,163,516 (GRCm39)	missense	probably damaging	0.98
IGL02544:Ubr4	APN	4	139,142,429 (GRCm39)	missense	probably damaging	1.00
IGL02622:Ubr4	APN	4	139,194,561 (GRCm39)	nonsense	probably null
IGL02679:Ubr4	APN	4	139,186,445 (GRCm39)	missense	probably damaging	0.99
IGL02728:Ubr4	APN	4	139,196,122 (GRCm39)	missense	probably damaging	1.00
IGL02754:Ubr4	APN	4	139,138,095 (GRCm39)	missense	probably damaging	0.99
IGL02754:Ubr4	APN	4	139,120,470 (GRCm39)	critical splice donor site	probably null
IGL02892:Ubr4	APN	4	139,144,642 (GRCm39)	missense	probably damaging	0.96
IGL02897:Ubr4	APN	4	139,199,819 (GRCm39)	missense	probably damaging	0.97
IGL02946:Ubr4	APN	4	139,152,606 (GRCm39)	missense	probably damaging	1.00
IGL02964:Ubr4	APN	4	139,135,131 (GRCm39)	missense	possibly damaging	0.84
IGL03059:Ubr4	APN	4	139,207,987 (GRCm39)	missense	probably damaging	0.98
IGL03068:Ubr4	APN	4	139,137,041 (GRCm39)	missense	probably benign	0.02
IGL03087:Ubr4	APN	4	139,177,668 (GRCm39)	nonsense	probably null
IGL03116:Ubr4	APN	4	139,206,892 (GRCm39)	splice site	probably benign
IGL03212:Ubr4	APN	4	139,137,074 (GRCm39)	missense	probably benign	0.13
IGL03228:Ubr4	APN	4	139,156,909 (GRCm39)	missense	probably damaging	1.00
IGL03292:Ubr4	APN	4	139,167,746 (GRCm39)	missense	probably damaging	1.00
IGL03388:Ubr4	APN	4	139,142,343 (GRCm39)	missense	probably damaging	0.98
IGL03393:Ubr4	APN	4	139,179,989 (GRCm39)	missense	probably damaging	1.00
IGL03409:Ubr4	APN	4	139,127,240 (GRCm39)	nonsense	probably null
Aqua_regia	UTSW	4	139,180,030 (GRCm39)	nonsense	probably null
Eats	UTSW	4	139,190,886 (GRCm39)	missense	probably damaging	0.97
Hardened	UTSW	4	139,196,158 (GRCm39)	missense	probably damaging	1.00
Stoney	UTSW	4	139,171,998 (GRCm39)	missense	probably damaging	1.00
Uber	UTSW	4	139,206,373 (GRCm39)	critical splice donor site	probably null
BB001:Ubr4	UTSW	4	139,194,587 (GRCm39)	missense	unknown
BB011:Ubr4	UTSW	4	139,194,587 (GRCm39)	missense	unknown
P0019:Ubr4	UTSW	4	139,179,092 (GRCm39)	missense	probably damaging	1.00
PIT4544001:Ubr4	UTSW	4	139,129,871 (GRCm39)	missense	possibly damaging	0.93
R0001:Ubr4	UTSW	4	139,179,099 (GRCm39)	missense	probably damaging	1.00
R0002:Ubr4	UTSW	4	139,118,211 (GRCm39)	missense	probably damaging	1.00
R0006:Ubr4	UTSW	4	139,158,960 (GRCm39)	missense	probably benign	0.03
R0006:Ubr4	UTSW	4	139,158,960 (GRCm39)	missense	probably benign	0.03
R0008:Ubr4	UTSW	4	139,157,487 (GRCm39)	missense	probably damaging	1.00
R0027:Ubr4	UTSW	4	139,127,704 (GRCm39)	missense	probably damaging	0.99
R0027:Ubr4	UTSW	4	139,127,704 (GRCm39)	missense	probably damaging	0.99
R0030:Ubr4	UTSW	4	139,154,104 (GRCm39)	missense	probably damaging	1.00
R0044:Ubr4	UTSW	4	139,164,369 (GRCm39)	splice site	probably benign
R0044:Ubr4	UTSW	4	139,164,369 (GRCm39)	splice site	probably benign
R0088:Ubr4	UTSW	4	139,168,125 (GRCm39)	missense	probably damaging	1.00
R0131:Ubr4	UTSW	4	139,191,362 (GRCm39)	missense	possibly damaging	0.66
R0184:Ubr4	UTSW	4	139,172,573 (GRCm39)	missense	probably damaging	1.00
R0219:Ubr4	UTSW	4	139,157,568 (GRCm39)	missense	possibly damaging	0.64
R0227:Ubr4	UTSW	4	139,158,960 (GRCm39)	missense	probably benign	0.03
R0270:Ubr4	UTSW	4	139,206,746 (GRCm39)	splice site	probably benign
R0285:Ubr4	UTSW	4	139,168,112 (GRCm39)	missense	probably damaging	1.00
R0322:Ubr4	UTSW	4	139,149,729 (GRCm39)	missense	probably damaging	1.00
R0363:Ubr4	UTSW	4	139,119,171 (GRCm39)	missense	probably damaging	0.98
R0393:Ubr4	UTSW	4	139,138,171 (GRCm39)	splice site	probably benign
R0450:Ubr4	UTSW	4	139,157,534 (GRCm39)	missense	probably benign	0.14
R0504:Ubr4	UTSW	4	139,133,889 (GRCm39)	missense	probably damaging	1.00
R0504:Ubr4	UTSW	4	139,208,149 (GRCm39)	critical splice donor site	probably null
R0510:Ubr4	UTSW	4	139,157,534 (GRCm39)	missense	probably benign	0.14
R0513:Ubr4	UTSW	4	139,144,186 (GRCm39)	missense	possibly damaging	0.74
R0517:Ubr4	UTSW	4	139,119,435 (GRCm39)	missense	probably benign	0.00
R0558:Ubr4	UTSW	4	139,154,213 (GRCm39)	missense	probably benign	0.09
R0617:Ubr4	UTSW	4	139,206,373 (GRCm39)	critical splice donor site	probably null
R0636:Ubr4	UTSW	4	139,163,613 (GRCm39)	splice site	probably null
R0637:Ubr4	UTSW	4	139,126,926 (GRCm39)	missense	probably damaging	1.00
R0652:Ubr4	UTSW	4	139,128,637 (GRCm39)	missense	probably damaging	0.99
R0691:Ubr4	UTSW	4	139,151,217 (GRCm39)	missense	probably damaging	1.00
R0729:Ubr4	UTSW	4	139,212,631 (GRCm39)	missense	possibly damaging	0.66
R0735:Ubr4	UTSW	4	139,155,339 (GRCm39)	splice site	probably null
R0751:Ubr4	UTSW	4	139,164,509 (GRCm39)	splice site	probably benign
R0789:Ubr4	UTSW	4	139,137,582 (GRCm39)	critical splice donor site	probably null
R0825:Ubr4	UTSW	4	139,206,887 (GRCm39)	critical splice donor site	probably null
R0828:Ubr4	UTSW	4	139,177,864 (GRCm39)	splice site	probably benign
R1052:Ubr4	UTSW	4	139,182,771 (GRCm39)	missense	possibly damaging	0.83
R1184:Ubr4	UTSW	4	139,164,509 (GRCm39)	splice site	probably benign
R1222:Ubr4	UTSW	4	139,115,782 (GRCm39)	splice site	probably null
R1258:Ubr4	UTSW	4	139,154,225 (GRCm39)	missense	probably damaging	1.00
R1321:Ubr4	UTSW	4	139,187,434 (GRCm39)	missense	possibly damaging	0.46
R1385:Ubr4	UTSW	4	139,129,923 (GRCm39)	missense	probably benign	0.00
R1450:Ubr4	UTSW	4	139,195,339 (GRCm39)	missense	probably damaging	1.00
R1470:Ubr4	UTSW	4	139,148,537 (GRCm39)	splice site	probably null
R1470:Ubr4	UTSW	4	139,148,537 (GRCm39)	splice site	probably null
R1474:Ubr4	UTSW	4	139,156,890 (GRCm39)	missense	probably damaging	1.00
R1479:Ubr4	UTSW	4	139,153,151 (GRCm39)	missense	possibly damaging	0.95
R1534:Ubr4	UTSW	4	139,155,462 (GRCm39)	missense	possibly damaging	0.95
R1546:Ubr4	UTSW	4	139,144,238 (GRCm39)	nonsense	probably null
R1785:Ubr4	UTSW	4	139,151,256 (GRCm39)	missense	probably damaging	1.00
R1786:Ubr4	UTSW	4	139,151,256 (GRCm39)	missense	probably damaging	1.00
R1789:Ubr4	UTSW	4	139,120,364 (GRCm39)	missense	probably damaging	1.00
R1796:Ubr4	UTSW	4	139,155,907 (GRCm39)	missense	probably benign	0.25
R1800:Ubr4	UTSW	4	139,135,274 (GRCm39)	missense	probably damaging	0.99
R1801:Ubr4	UTSW	4	139,179,874 (GRCm39)	splice site	probably null
R1827:Ubr4	UTSW	4	139,153,008 (GRCm39)	critical splice acceptor site	probably null
R1887:Ubr4	UTSW	4	139,182,871 (GRCm39)	missense	probably damaging	1.00
R1966:Ubr4	UTSW	4	139,178,555 (GRCm39)	critical splice acceptor site	probably null
R2010:Ubr4	UTSW	4	139,207,963 (GRCm39)	missense	possibly damaging	0.92
R2049:Ubr4	UTSW	4	139,204,518 (GRCm39)	missense	probably damaging	0.97
R2069:Ubr4	UTSW	4	139,206,851 (GRCm39)	missense	possibly damaging	0.66
R2114:Ubr4	UTSW	4	139,156,922 (GRCm39)	nonsense	probably null
R2140:Ubr4	UTSW	4	139,204,518 (GRCm39)	missense	probably damaging	0.97
R2141:Ubr4	UTSW	4	139,204,518 (GRCm39)	missense	probably damaging	0.97
R2142:Ubr4	UTSW	4	139,204,518 (GRCm39)	missense	probably damaging	0.97
R2168:Ubr4	UTSW	4	139,137,960 (GRCm39)	missense	probably benign	0.25
R2237:Ubr4	UTSW	4	139,170,101 (GRCm39)	missense	probably damaging	1.00
R2249:Ubr4	UTSW	4	139,176,232 (GRCm39)	missense	probably damaging	1.00
R2261:Ubr4	UTSW	4	139,140,773 (GRCm39)	missense	probably damaging	0.99
R2264:Ubr4	UTSW	4	139,147,684 (GRCm39)	splice site	probably benign
R2353:Ubr4	UTSW	4	139,160,984 (GRCm39)	missense	possibly damaging	0.48
R2437:Ubr4	UTSW	4	139,200,853 (GRCm39)	missense	possibly damaging	0.90
R2496:Ubr4	UTSW	4	139,200,516 (GRCm39)	unclassified	probably benign
R2896:Ubr4	UTSW	4	139,182,955 (GRCm39)	splice site	probably null
R2922:Ubr4	UTSW	4	139,206,811 (GRCm39)	missense	possibly damaging	0.66
R2972:Ubr4	UTSW	4	139,133,847 (GRCm39)	missense	probably benign	0.22
R2973:Ubr4	UTSW	4	139,133,847 (GRCm39)	missense	probably benign	0.22
R2989:Ubr4	UTSW	4	139,190,869 (GRCm39)	missense	possibly damaging	0.89
R3176:Ubr4	UTSW	4	139,149,166 (GRCm39)	missense	probably benign	0.03
R3276:Ubr4	UTSW	4	139,149,166 (GRCm39)	missense	probably benign	0.03
R3772:Ubr4	UTSW	4	139,180,011 (GRCm39)	missense	possibly damaging	0.89
R3844:Ubr4	UTSW	4	139,186,437 (GRCm39)	missense	probably damaging	0.99
R3873:Ubr4	UTSW	4	139,151,301 (GRCm39)	missense	probably damaging	1.00
R3900:Ubr4	UTSW	4	139,206,373 (GRCm39)	critical splice donor site	probably null
R3951:Ubr4	UTSW	4	139,120,405 (GRCm39)	missense	probably damaging	1.00
R4020:Ubr4	UTSW	4	139,179,116 (GRCm39)	missense	probably damaging	0.98
R4178:Ubr4	UTSW	4	139,120,725 (GRCm39)	missense	probably damaging	1.00
R4308:Ubr4	UTSW	4	139,199,820 (GRCm39)	missense	possibly damaging	0.46
R4378:Ubr4	UTSW	4	139,137,751 (GRCm39)	missense	possibly damaging	0.76
R4400:Ubr4	UTSW	4	139,189,167 (GRCm39)	missense	possibly damaging	0.66
R4421:Ubr4	UTSW	4	139,189,167 (GRCm39)	missense	possibly damaging	0.66
R4462:Ubr4	UTSW	4	139,145,813 (GRCm39)	missense	possibly damaging	0.47
R4583:Ubr4	UTSW	4	139,108,164 (GRCm39)	missense	possibly damaging	0.82
R4611:Ubr4	UTSW	4	139,126,890 (GRCm39)	missense	possibly damaging	0.93
R4664:Ubr4	UTSW	4	139,133,829 (GRCm39)	missense	possibly damaging	0.56
R4671:Ubr4	UTSW	4	139,163,502 (GRCm39)	missense	possibly damaging	0.66
R4672:Ubr4	UTSW	4	139,138,027 (GRCm39)	missense	probably damaging	0.99
R4673:Ubr4	UTSW	4	139,138,027 (GRCm39)	missense	probably damaging	0.99
R4696:Ubr4	UTSW	4	139,135,983 (GRCm39)	missense	probably benign	0.09
R4701:Ubr4	UTSW	4	139,198,647 (GRCm39)	missense	possibly damaging	0.66
R4705:Ubr4	UTSW	4	139,177,840 (GRCm39)	missense	probably damaging	1.00
R4726:Ubr4	UTSW	4	139,209,890 (GRCm39)	missense	possibly damaging	0.46
R4728:Ubr4	UTSW	4	139,151,190 (GRCm39)	missense	probably damaging	1.00
R4783:Ubr4	UTSW	4	139,149,044 (GRCm39)	missense	possibly damaging	0.85
R4833:Ubr4	UTSW	4	139,129,857 (GRCm39)	missense	probably damaging	0.98
R4892:Ubr4	UTSW	4	139,155,828 (GRCm39)	missense	probably benign	0.14
R4936:Ubr4	UTSW	4	139,123,877 (GRCm39)	missense	probably damaging	0.98
R5000:Ubr4	UTSW	4	139,163,480 (GRCm39)	missense	probably damaging	0.98
R5114:Ubr4	UTSW	4	139,137,934 (GRCm39)	missense	probably damaging	0.99
R5189:Ubr4	UTSW	4	139,137,960 (GRCm39)	missense	probably benign	0.25
R5197:Ubr4	UTSW	4	139,195,408 (GRCm39)	missense	probably damaging	1.00
R5213:Ubr4	UTSW	4	139,129,877 (GRCm39)	nonsense	probably null
R5219:Ubr4	UTSW	4	139,204,543 (GRCm39)	nonsense	probably null
R5346:Ubr4	UTSW	4	139,155,802 (GRCm39)	missense	probably damaging	0.97
R5368:Ubr4	UTSW	4	139,124,839 (GRCm39)	intron	probably benign
R5442:Ubr4	UTSW	4	139,135,083 (GRCm39)	missense	probably damaging	1.00
R5527:Ubr4	UTSW	4	139,208,099 (GRCm39)	missense	possibly damaging	0.83
R5548:Ubr4	UTSW	4	139,187,401 (GRCm39)	missense	probably damaging	0.97
R5568:Ubr4	UTSW	4	139,119,349 (GRCm39)	missense	probably damaging	0.99
R5639:Ubr4	UTSW	4	139,179,959 (GRCm39)	missense	possibly damaging	0.66
R5643:Ubr4	UTSW	4	139,171,998 (GRCm39)	missense	probably damaging	1.00
R5663:Ubr4	UTSW	4	139,155,894 (GRCm39)	missense	possibly damaging	0.95
R5755:Ubr4	UTSW	4	139,187,406 (GRCm39)	missense	possibly damaging	0.66
R5781:Ubr4	UTSW	4	139,195,407 (GRCm39)	missense	probably damaging	1.00
R5784:Ubr4	UTSW	4	139,152,529 (GRCm39)	missense	probably damaging	1.00
R5817:Ubr4	UTSW	4	139,196,158 (GRCm39)	missense	probably damaging	1.00
R5872:Ubr4	UTSW	4	139,152,641 (GRCm39)	missense	probably damaging	0.98
R5891:Ubr4	UTSW	4	139,135,937 (GRCm39)	nonsense	probably null
R5901:Ubr4	UTSW	4	139,178,565 (GRCm39)	missense	probably damaging	1.00
R5958:Ubr4	UTSW	4	139,182,949 (GRCm39)	missense	probably damaging	1.00
R5974:Ubr4	UTSW	4	139,148,389 (GRCm39)	splice site	probably null
R6065:Ubr4	UTSW	4	139,148,549 (GRCm39)	missense	probably damaging	1.00
R6109:Ubr4	UTSW	4	139,144,675 (GRCm39)	missense	probably damaging	0.99
R6207:Ubr4	UTSW	4	139,148,559 (GRCm39)	missense	probably damaging	1.00
R6265:Ubr4	UTSW	4	139,179,951 (GRCm39)	missense	possibly damaging	0.90
R6319:Ubr4	UTSW	4	139,136,200 (GRCm39)	missense	possibly damaging	0.84
R6342:Ubr4	UTSW	4	139,156,850 (GRCm39)	missense	possibly damaging	0.88
R6434:Ubr4	UTSW	4	139,156,949 (GRCm39)	missense	probably damaging	1.00
R6437:Ubr4	UTSW	4	139,124,525 (GRCm39)	critical splice donor site	probably null
R6481:Ubr4	UTSW	4	139,159,062 (GRCm39)	missense	probably damaging	0.97
R6502:Ubr4	UTSW	4	139,171,982 (GRCm39)	missense	probably damaging	1.00
R6546:Ubr4	UTSW	4	139,141,705 (GRCm39)	missense	probably damaging	0.99
R6603:Ubr4	UTSW	4	139,182,897 (GRCm39)	missense	probably benign	0.17
R6648:Ubr4	UTSW	4	139,180,030 (GRCm39)	nonsense	probably null
R6649:Ubr4	UTSW	4	139,200,935 (GRCm39)	missense	possibly damaging	0.66
R6653:Ubr4	UTSW	4	139,200,935 (GRCm39)	missense	possibly damaging	0.66
R6668:Ubr4	UTSW	4	139,192,652 (GRCm39)	missense	probably damaging	1.00
R6770:Ubr4	UTSW	4	139,216,493 (GRCm39)	missense	unknown
R6772:Ubr4	UTSW	4	139,194,541 (GRCm39)	nonsense	probably null
R6857:Ubr4	UTSW	4	139,213,362 (GRCm39)	missense	possibly damaging	0.90
R6869:Ubr4	UTSW	4	139,194,538 (GRCm39)	missense	possibly damaging	0.93
R6912:Ubr4	UTSW	4	139,185,545 (GRCm39)	critical splice donor site	probably null
R6943:Ubr4	UTSW	4	139,164,442 (GRCm39)	nonsense	probably null
R6970:Ubr4	UTSW	4	139,133,839 (GRCm39)	nonsense	probably null
R6976:Ubr4	UTSW	4	139,120,388 (GRCm39)	missense	probably damaging	0.98
R7000:Ubr4	UTSW	4	139,141,715 (GRCm39)	missense	probably damaging	1.00
R7017:Ubr4	UTSW	4	139,120,401 (GRCm39)	missense	probably damaging	0.99
R7165:Ubr4	UTSW	4	139,177,824 (GRCm39)	missense
R7222:Ubr4	UTSW	4	139,190,684 (GRCm39)	missense	unknown
R7241:Ubr4	UTSW	4	139,170,725 (GRCm39)	missense	probably damaging	1.00
R7343:Ubr4	UTSW	4	139,140,749 (GRCm39)	missense	probably benign	0.09
R7367:Ubr4	UTSW	4	139,180,002 (GRCm39)	missense	unknown
R7432:Ubr4	UTSW	4	139,115,693 (GRCm39)	missense	probably damaging	1.00
R7448:Ubr4	UTSW	4	139,189,778 (GRCm39)	missense	unknown
R7502:Ubr4	UTSW	4	139,139,983 (GRCm39)	missense	possibly damaging	0.72
R7514:Ubr4	UTSW	4	139,179,966 (GRCm39)	missense	unknown
R7526:Ubr4	UTSW	4	139,149,728 (GRCm39)	missense	probably benign	0.00
R7529:Ubr4	UTSW	4	139,149,728 (GRCm39)	missense	probably benign	0.00
R7666:Ubr4	UTSW	4	139,140,791 (GRCm39)	missense	possibly damaging	0.81
R7699:Ubr4	UTSW	4	139,136,178 (GRCm39)	nonsense	probably null
R7700:Ubr4	UTSW	4	139,136,178 (GRCm39)	nonsense	probably null
R7726:Ubr4	UTSW	4	139,186,231 (GRCm39)	missense	unknown
R7753:Ubr4	UTSW	4	139,197,603 (GRCm39)	missense	unknown
R7810:Ubr4	UTSW	4	139,142,394 (GRCm39)	missense
R7837:Ubr4	UTSW	4	139,120,462 (GRCm39)	nonsense	probably null
R7868:Ubr4	UTSW	4	139,187,344 (GRCm39)	missense	unknown
R7872:Ubr4	UTSW	4	139,120,373 (GRCm39)	missense	possibly damaging	0.94
R7887:Ubr4	UTSW	4	139,135,121 (GRCm39)	missense	probably damaging	0.99
R7924:Ubr4	UTSW	4	139,194,587 (GRCm39)	missense	unknown
R7980:Ubr4	UTSW	4	139,145,717 (GRCm39)	missense
R7982:Ubr4	UTSW	4	139,155,519 (GRCm39)	critical splice donor site	probably null
R8005:Ubr4	UTSW	4	139,139,941 (GRCm39)	missense	probably damaging	0.98
R8054:Ubr4	UTSW	4	139,195,413 (GRCm39)	missense	unknown
R8094:Ubr4	UTSW	4	139,168,007 (GRCm39)	missense	probably damaging	0.97
R8151:Ubr4	UTSW	4	139,130,112 (GRCm39)	missense	probably damaging	0.97
R8183:Ubr4	UTSW	4	139,209,782 (GRCm39)	missense	unknown
R8252:Ubr4	UTSW	4	139,200,528 (GRCm39)	missense	unknown
R8505:Ubr4	UTSW	4	139,156,880 (GRCm39)	missense
R8519:Ubr4	UTSW	4	139,143,958 (GRCm39)	missense	probably damaging	0.97
R8716:Ubr4	UTSW	4	139,196,164 (GRCm39)	missense	unknown
R8720:Ubr4	UTSW	4	139,208,149 (GRCm39)	critical splice donor site	probably null
R8749:Ubr4	UTSW	4	139,129,935 (GRCm39)	missense	probably damaging	0.98
R8768:Ubr4	UTSW	4	139,149,076 (GRCm39)	missense
R8789:Ubr4	UTSW	4	139,137,494 (GRCm39)	missense	possibly damaging	0.76
R8879:Ubr4	UTSW	4	139,137,829 (GRCm39)	missense	probably benign	0.06
R8937:Ubr4	UTSW	4	139,190,886 (GRCm39)	missense	probably damaging	0.97
R9006:Ubr4	UTSW	4	139,172,003 (GRCm39)	critical splice donor site	probably null
R9116:Ubr4	UTSW	4	139,145,785 (GRCm39)	missense
R9134:Ubr4	UTSW	4	139,127,755 (GRCm39)	critical splice donor site	probably null
R9251:Ubr4	UTSW	4	139,177,636 (GRCm39)	missense
R9340:Ubr4	UTSW	4	139,182,763 (GRCm39)	missense	unknown
R9384:Ubr4	UTSW	4	139,194,631 (GRCm39)	missense	unknown
R9389:Ubr4	UTSW	4	139,153,235 (GRCm39)	missense
R9393:Ubr4	UTSW	4	139,212,613 (GRCm39)	missense	unknown
R9531:Ubr4	UTSW	4	139,135,217 (GRCm39)	missense	probably benign	0.00
R9573:Ubr4	UTSW	4	139,148,450 (GRCm39)	missense
R9604:Ubr4	UTSW	4	139,159,827 (GRCm39)	critical splice donor site	probably null
R9613:Ubr4	UTSW	4	139,149,073 (GRCm39)	missense
R9623:Ubr4	UTSW	4	139,159,024 (GRCm39)	missense	probably benign	0.00
R9651:Ubr4	UTSW	4	139,206,859 (GRCm39)	missense	unknown
R9685:Ubr4	UTSW	4	139,191,341 (GRCm39)	missense	unknown
R9698:Ubr4	UTSW	4	139,167,975 (GRCm39)	missense
R9700:Ubr4	UTSW	4	139,119,388 (GRCm39)	missense	probably damaging	0.97
R9727:Ubr4	UTSW	4	139,140,735 (GRCm39)	missense	probably damaging	0.98
R9766:Ubr4	UTSW	4	139,194,595 (GRCm39)	missense	unknown
T0975:Ubr4	UTSW	4	139,179,092 (GRCm39)	missense	probably damaging	1.00
X0028:Ubr4	UTSW	4	139,137,582 (GRCm39)	critical splice donor site	probably null
Z1176:Ubr4	UTSW	4	139,137,456 (GRCm39)	missense	probably damaging	1.00
Z1176:Ubr4	UTSW	4	139,129,971 (GRCm39)	missense	probably benign	0.04
Z1176:Ubr4	UTSW	4	139,127,696 (GRCm39)	missense	probably damaging	1.00
Z1177:Ubr4	UTSW	4	139,177,792 (GRCm39)	missense
Z1186:Ubr4	UTSW	4	139,137,964 (GRCm39)	missense	probably benign	0.02

Predicted Primers

PCR Primer
(F):5'- TAAGCTGCCTGTCAAAGCCATAC -3'
(R):5'- TCACTGAGAGAGGGTGTCTG -3'

Sequencing Primer
(F):5'- AGCATAGAATTTTGTGAGCACG -3'
(R):5'- TGTCTGGGAGGCCAGGGAG -3'

Posted On

2019-09-13