Mutagenetix > Incidental Mutations

Incidental Mutation 'R7393:Chfr'

573587

Institutional Source

Beutler Lab

Gene Symbol

Chfr

Ensembl Gene

ENSMUSG00000014668

Gene Name

checkpoint with forkhead and ring finger domains

Synonyms

RNF116, 5730484M20Rik

MMRRC Submission

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.215) question?

Stock #

R7393 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

110135842-110171972 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 110152358 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Phenylalanine to Isoleucine at position 323 (F323I)

Ref Sequence

ENSEMBL: ENSMUSP00000108138 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000014812] [ENSMUST00000112519] [ENSMUST00000198066] [ENSMUST00000198633] [ENSMUST00000199557] [ENSMUST00000199672]

AlphaFold

Q810L3

Predicted Effect

possibly damaging
Transcript: ENSMUST00000014812
AA Change: F323I

PolyPhen 2 Score 0.936 (Sensitivity: 0.80; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000014812
Gene: ENSMUSG00000014668
AA Change: F323I

Domain	Start	End	E-Value	Type
low complexity region	6	15	N/A	INTRINSIC
FHA	37	89	1.09e-6	SMART
low complexity region	203	215	N/A	INTRINSIC
RING	303	341	2.63e-4	SMART
low complexity region	396	421	N/A	INTRINSIC
RING	443	512	3.53e0	SMART
Blast:VWA	593	655	3e-12	BLAST

Predicted Effect

probably damaging
Transcript: ENSMUST00000112519
AA Change: F323I

PolyPhen 2 Score 0.978 (Sensitivity: 0.76; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000108138
Gene: ENSMUSG00000014668
AA Change: F323I

Domain	Start	End	E-Value	Type
low complexity region	6	15	N/A	INTRINSIC
FHA	37	89	1.09e-6	SMART
low complexity region	203	215	N/A	INTRINSIC
RING	303	341	2.63e-4	SMART
low complexity region	396	421	N/A	INTRINSIC
RING	443	513	3.63e0	SMART
Blast:VWA	594	656	3e-12	BLAST

Predicted Effect

probably benign
Transcript: ENSMUST00000198066

Predicted Effect

possibly damaging
Transcript: ENSMUST00000198633
AA Change: F251I

PolyPhen 2 Score 0.936 (Sensitivity: 0.80; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000143480
Gene: ENSMUSG00000014668
AA Change: F251I

Domain	Start	End	E-Value	Type
low complexity region	6	15	N/A	INTRINSIC
FHA	37	89	1.09e-6	SMART
RING	231	269	2.63e-4	SMART
low complexity region	324	349	N/A	INTRINSIC
RING	371	441	3.63e0	SMART
Blast:VWA	522	584	2e-12	BLAST

Predicted Effect

probably benign
Transcript: ENSMUST00000199557

SMART Domains

Protein: ENSMUSP00000143113
Gene: ENSMUSG00000014668

Domain	Start	End	E-Value	Type
SCOP:d1lgpa_	14	44	4e-5	SMART
PDB:1LGQ\|B	16	44	1e-10	PDB

Predicted Effect

probably benign
Transcript: ENSMUST00000199672

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 99.1%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an E3 ubiquitin-protein ligase required for the maintenance of the antephase checkpoint that regulates cell cycle entry into mitosis and, therefore, may play a key role in cell cycle progression and tumorigenesis. The encoded protein has an N-terminal forkhead-associated domain, a central RING-finger domain, and a cysteine-rich C-terminal region. Alternatively spliced transcript variants that encode different protein isoforms have been described. [provided by RefSeq, Mar 2014]
PHENOTYPE: Homozygous null mice and MEFs display increased tumor incidence and inducibility, premature death, increased chromosomal instability, and cell cycle abnormalities. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 69 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2010107E04Rik	A	G	12: 111,963,277	V26A	probably benign	Het
Abcb11	C	T	2: 69,299,867	D282N	probably damaging	Het
Abi2	T	C	1: 60,434,382	M86T	possibly damaging	Het
Adam26a	T	C	8: 43,569,688	N255S	probably benign	Het
Adam4	G	A	12: 81,419,660	S729L	probably benign	Het
Adcy1	G	T	11: 7,137,381	W418C	probably damaging	Het
Add2	T	A	6: 86,098,647	Y259*	probably null	Het
Agl	A	T	3: 116,791,156	C172S	probably benign	Het
Ankfy1	A	G	11: 72,738,308	T319A	possibly damaging	Het
Armc8	A	T	9: 99,483,999	C621S	possibly damaging	Het
Bbc3	A	G	7: 16,313,789	D146G	probably benign	Het
Btnl10	T	C	11: 58,923,706	L404P	probably damaging	Het
Cbl	A	G	9: 44,154,188		probably null	Het
Ccdc170	T	A	10: 4,514,314		probably null	Het
Ccdc91	T	A	6: 147,534,029	V37E	possibly damaging	Het
Ces1e	G	T	8: 93,210,417	T343K	probably benign	Het
Clcnkb	T	A	4: 141,409,445	M370L	probably benign	Het
Col11a1	A	G	3: 114,097,106	D364G	unknown	Het
Ctbp2	A	G	7: 132,988,292	I381T	probably benign	Het
Cyp4a29	A	C	4: 115,242,196	Y38S	probably damaging	Het
Ddx1	T	C	12: 13,230,353	D382G	probably benign	Het
Dhx57	T	A	17: 80,255,571	N876Y	probably damaging	Het
Dsel	C	T	1: 111,861,573	G411S	probably damaging	Het
Enpp5	G	A	17: 44,085,264	G356S	probably damaging	Het
Fam234a	T	C	17: 26,216,624	D262G	probably benign	Het
Fnbp4	C	A	2: 90,779,316	Q1035K	probably damaging	Het
Gbp11	T	A	5: 105,327,577	N302Y	possibly damaging	Het
Gm11554	T	A	11: 99,803,872	T172S	unknown	Het
Hamp2	A	T	7: 30,922,605	M53K	possibly damaging	Het
Kcnj1	A	G	9: 32,397,018	D246G	probably damaging	Het
Kctd20	T	C	17: 28,963,338	F209L	probably damaging	Het
Klra2	T	C	6: 131,230,202	Y148C	probably damaging	Het
Krtap15	T	C	16: 88,829,097		probably null	Het
Mrps23	T	C	11: 88,204,458	L6P	probably damaging	Het
Ms4a6d	G	A	19: 11,590,073	Q155*	probably null	Het
Myo7a	G	A	7: 98,063,699	R1690C	possibly damaging	Het
Nbas	T	C	12: 13,393,492	S1183P	probably damaging	Het
Ndufaf4	T	A	4: 24,903,177	M122K	probably benign	Het
Nop2	C	A	6: 125,133,546	S45*	probably null	Het
Nop56	T	A	2: 130,274,638	L3Q	probably benign	Het
Nrp2	T	C	1: 62,745,424	I244T	probably damaging	Het
Olfr1426	T	A	19: 12,088,628	T55S	probably benign	Het
Olfr620	A	G	7: 103,611,991	S121P	possibly damaging	Het
Otof	T	C	5: 30,370,270	D1941G	probably benign	Het
Pcyox1l	T	C	18: 61,697,641	K387E	probably benign	Het
Plcg2	A	G	8: 117,579,825	Y306C	possibly damaging	Het
Ppp1r13b	G	A	12: 111,838,754	P333S	probably damaging	Het
Rcc2	A	G	4: 140,717,030	D344G	probably damaging	Het
Reln	A	T	5: 21,976,351	N1810K	probably damaging	Het
Rfesd	G	T	13: 76,003,030	A90E	probably benign	Het
Rsf1	CGGCGGCGG	CGGCGGCGGGGGCGGCGG	7: 97,579,917		probably benign	Het
Scg2	T	C	1: 79,435,231	K552E	probably damaging	Het
Sdccag8	A	G	1: 176,840,306	I190V	probably benign	Het
Sele	C	A	1: 164,053,923	T533K	probably benign	Het
Sh3bp4	T	A	1: 89,144,448	H339Q	possibly damaging	Het
Slc6a19	A	G	13: 73,692,974	S106P	probably benign	Het
Spidr	C	T	16: 16,146,831		probably benign	Het
Stk36	A	T	1: 74,611,193	K295*	probably null	Het
Synj1	A	T	16: 90,951,999	D1056E	probably damaging	Het
Tnks1bp1	T	C	2: 85,062,866	S1046P	probably benign	Het
Ttc27	T	G	17: 74,770,264	F385V	possibly damaging	Het
Ttn	C	A	2: 76,944,345	G2164W	unknown	Het
Ubap1	T	A	4: 41,379,764	L326*	probably null	Het
Ubr4	A	G	4: 139,426,785	N812S	probably damaging	Het
Vmn1r160	A	G	7: 22,871,353	T44A	possibly damaging	Het
Vmn1r28	G	A	6: 58,265,589	S139N	possibly damaging	Het
Vmn2r116	A	G	17: 23,386,125	I137M	probably benign	Het
Vmn2r67	A	T	7: 85,155,878	W9R	probably null	Het
Zfp101	T	C	17: 33,386,700	N45D	possibly damaging	Het

Other mutations in Chfr

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01333:Chfr	APN	5	110143573	missense	possibly damaging	0.94
IGL01479:Chfr	APN	5	110144993	unclassified	probably benign
IGL02543:Chfr	APN	5	110143547	splice site	probably null
IGL02657:Chfr	APN	5	110154839	missense	probably damaging	1.00
IGL03057:Chfr	APN	5	110143609	missense	probably benign	0.14
PIT4445001:Chfr	UTSW	5	110151677	missense	possibly damaging	0.88
R0938:Chfr	UTSW	5	110164058	missense	probably damaging	1.00
R1346:Chfr	UTSW	5	110140447	missense	probably damaging	1.00
R1561:Chfr	UTSW	5	110158808	missense	probably benign	0.05
R1602:Chfr	UTSW	5	110151665	missense	probably benign	0.26
R1658:Chfr	UTSW	5	110153169	missense	probably damaging	1.00
R2134:Chfr	UTSW	5	110144761	splice site	probably null
R2234:Chfr	UTSW	5	110170863	missense	probably damaging	1.00
R4371:Chfr	UTSW	5	110136168	missense	probably damaging	0.99
R4420:Chfr	UTSW	5	110170880	nonsense	probably null
R4666:Chfr	UTSW	5	110144867	nonsense	probably null
R4742:Chfr	UTSW	5	110143598	missense	probably benign	0.04
R4809:Chfr	UTSW	5	110158834	missense	probably damaging	1.00
R5490:Chfr	UTSW	5	110153129	missense	possibly damaging	0.88
R5581:Chfr	UTSW	5	110153282	critical splice donor site	probably null
R5820:Chfr	UTSW	5	110162739	missense	possibly damaging	0.94
R6012:Chfr	UTSW	5	110144651	critical splice donor site	probably null
R7128:Chfr	UTSW	5	110143636	missense	probably benign	0.33
R7166:Chfr	UTSW	5	110158805	missense	probably benign
R7278:Chfr	UTSW	5	110140360	missense	probably benign	0.23
R7422:Chfr	UTSW	5	110162705	splice site	probably null
R7499:Chfr	UTSW	5	110151683	missense	probably benign	0.40
R8224:Chfr	UTSW	5	110160243	critical splice donor site	probably null
R8264:Chfr	UTSW	5	110152434	missense	possibly damaging	0.86
R8325:Chfr	UTSW	5	110162763	nonsense	probably null
R8333:Chfr	UTSW	5	110154937	missense	probably benign	0.05
R8823:Chfr	UTSW	5	110152392	missense	probably damaging	0.96
R9024:Chfr	UTSW	5	110158832	missense	probably benign	0.26
R9419:Chfr	UTSW	5	110169190
X0013:Chfr	UTSW	5	110151579	missense	probably benign	0.19
Z1176:Chfr	UTSW	5	110144895	nonsense	probably null

Predicted Primers

PCR Primer
(F):5'- GTGTCTTCTAACACTGAGCTTTAAG -3'
(R):5'- TGGCTCAGGGCATAGCTTC -3'

Sequencing Primer
(F):5'- GGTTAGGTGATACAATTCTCCACAG -3'
(R):5'- ATAGCTTCAGCCCCAGGTC -3'

Posted On

2019-09-13