Incidental Mutation 'R7393:Vmn1r28'
ID573588
Institutional Source Beutler Lab
Gene Symbol Vmn1r28
Ensembl Gene ENSMUSG00000115705
Gene Namevomeronasal 1 receptor 28
SynonymsV1rc25
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.151) question?
Stock #R7393 (G1)
Quality Score225.009
Status Not validated
Chromosome6
Chromosomal Location58262037-58275639 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 58265589 bp
ZygosityHeterozygous
Amino Acid Change Serine to Asparagine at position 139 (S139N)
Ref Sequence ENSEMBL: ENSMUSP00000153799 (fasta)
Predicted Effect possibly damaging
Transcript: ENSMUST00000226813
AA Change: S139N

PolyPhen 2 Score 0.814 (Sensitivity: 0.84; Specificity: 0.93)
Predicted Effect possibly damaging
Transcript: ENSMUST00000227805
AA Change: S139N

PolyPhen 2 Score 0.814 (Sensitivity: 0.84; Specificity: 0.93)
Predicted Effect possibly damaging
Transcript: ENSMUST00000228678
AA Change: S139N

PolyPhen 2 Score 0.814 (Sensitivity: 0.84; Specificity: 0.93)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010107E04Rik A G 12: 111,963,277 V26A probably benign Het
Abcb11 C T 2: 69,299,867 D282N probably damaging Het
Abi2 T C 1: 60,434,382 M86T possibly damaging Het
Adam26a T C 8: 43,569,688 N255S probably benign Het
Adam4 G A 12: 81,419,660 S729L probably benign Het
Adcy1 G T 11: 7,137,381 W418C probably damaging Het
Add2 T A 6: 86,098,647 Y259* probably null Het
Agl A T 3: 116,791,156 C172S probably benign Het
Ankfy1 A G 11: 72,738,308 T319A possibly damaging Het
Armc8 A T 9: 99,483,999 C621S possibly damaging Het
Bbc3 A G 7: 16,313,789 D146G probably benign Het
Btnl10 T C 11: 58,923,706 L404P probably damaging Het
Cbl A G 9: 44,154,188 probably null Het
Ccdc170 T A 10: 4,514,314 probably null Het
Ccdc91 T A 6: 147,534,029 V37E possibly damaging Het
Ces1e G T 8: 93,210,417 T343K probably benign Het
Chfr T A 5: 110,152,358 F323I probably damaging Het
Clcnkb T A 4: 141,409,445 M370L probably benign Het
Col11a1 A G 3: 114,097,106 D364G unknown Het
Ctbp2 A G 7: 132,988,292 I381T probably benign Het
Cyp4a29 A C 4: 115,242,196 Y38S probably damaging Het
Ddx1 T C 12: 13,230,353 D382G probably benign Het
Dhx57 T A 17: 80,255,571 N876Y probably damaging Het
Dsel C T 1: 111,861,573 G411S probably damaging Het
Enpp5 G A 17: 44,085,264 G356S probably damaging Het
Fam234a T C 17: 26,216,624 D262G probably benign Het
Fnbp4 C A 2: 90,779,316 Q1035K probably damaging Het
Gbp11 T A 5: 105,327,577 N302Y possibly damaging Het
Gm11554 T A 11: 99,803,872 T172S unknown Het
Hamp2 A T 7: 30,922,605 M53K possibly damaging Het
Kcnj1 A G 9: 32,397,018 D246G probably damaging Het
Kctd20 T C 17: 28,963,338 F209L probably damaging Het
Klra2 T C 6: 131,230,202 Y148C probably damaging Het
Krtap15 T C 16: 88,829,097 probably null Het
Mrps23 T C 11: 88,204,458 L6P probably damaging Het
Ms4a6d G A 19: 11,590,073 Q155* probably null Het
Myo7a G A 7: 98,063,699 R1690C possibly damaging Het
Nbas T C 12: 13,393,492 S1183P probably damaging Het
Ndufaf4 T A 4: 24,903,177 M122K probably benign Het
Nop2 C A 6: 125,133,546 S45* probably null Het
Nop56 T A 2: 130,274,638 L3Q probably benign Het
Nrp2 T C 1: 62,745,424 I244T probably damaging Het
Olfr1426 T A 19: 12,088,628 T55S probably benign Het
Olfr620 A G 7: 103,611,991 S121P possibly damaging Het
Otof T C 5: 30,370,270 D1941G probably benign Het
Pcyox1l T C 18: 61,697,641 K387E probably benign Het
Plcg2 A G 8: 117,579,825 Y306C possibly damaging Het
Ppp1r13b G A 12: 111,838,754 P333S probably damaging Het
Rcc2 A G 4: 140,717,030 D344G probably damaging Het
Reln A T 5: 21,976,351 N1810K probably damaging Het
Rfesd G T 13: 76,003,030 A90E probably benign Het
Rsf1 CGGCGGCGG CGGCGGCGGGGGCGGCGG 7: 97,579,917 probably benign Het
Scg2 T C 1: 79,435,231 K552E probably damaging Het
Sdccag8 A G 1: 176,840,306 I190V probably benign Het
Sele C A 1: 164,053,923 T533K probably benign Het
Sh3bp4 T A 1: 89,144,448 H339Q possibly damaging Het
Slc6a19 A G 13: 73,692,974 S106P probably benign Het
Spidr C T 16: 16,146,831 probably benign Het
Stk36 A T 1: 74,611,193 K295* probably null Het
Synj1 A T 16: 90,951,999 D1056E probably damaging Het
Tnks1bp1 T C 2: 85,062,866 S1046P probably benign Het
Ttc27 T G 17: 74,770,264 F385V possibly damaging Het
Ttn C A 2: 76,944,345 G2164W unknown Het
Ubap1 T A 4: 41,379,764 L326* probably null Het
Ubr4 A G 4: 139,426,785 N812S probably damaging Het
Vmn1r160 A G 7: 22,871,353 T44A possibly damaging Het
Vmn2r116 A G 17: 23,386,125 I137M probably benign Het
Vmn2r67 A T 7: 85,155,878 W9R probably null Het
Zfp101 T C 17: 33,386,700 N45D possibly damaging Het
Other mutations in Vmn1r28
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01365:Vmn1r28 APN 6 58265191 missense possibly damaging 0.76
IGL01712:Vmn1r28 APN 6 58265408 missense probably benign 0.00
IGL01788:Vmn1r28 APN 6 58265537 missense probably benign 0.00
IGL02629:Vmn1r28 APN 6 58265816 missense probably benign 0.00
R0001:Vmn1r28 UTSW 6 58265717 missense probably benign 0.00
R0009:Vmn1r28 UTSW 6 58265717 missense probably benign 0.00
R0040:Vmn1r28 UTSW 6 58265894 missense probably damaging 1.00
R0078:Vmn1r28 UTSW 6 58265717 missense probably benign 0.00
R0079:Vmn1r28 UTSW 6 58265717 missense probably benign 0.00
R0081:Vmn1r28 UTSW 6 58265717 missense probably benign 0.00
R0164:Vmn1r28 UTSW 6 58265717 missense probably benign 0.00
R0164:Vmn1r28 UTSW 6 58265717 missense probably benign 0.00
R0165:Vmn1r28 UTSW 6 58265717 missense probably benign 0.00
R0166:Vmn1r28 UTSW 6 58265717 missense probably benign 0.00
R0167:Vmn1r28 UTSW 6 58265717 missense probably benign 0.00
R0172:Vmn1r28 UTSW 6 58265717 missense probably benign 0.00
R0173:Vmn1r28 UTSW 6 58265717 missense probably benign 0.00
R0284:Vmn1r28 UTSW 6 58265717 missense probably benign 0.00
R0288:Vmn1r28 UTSW 6 58265717 missense probably benign 0.00
R0704:Vmn1r28 UTSW 6 58265717 missense probably benign 0.00
R1143:Vmn1r28 UTSW 6 58265742 missense probably benign 0.00
R1225:Vmn1r28 UTSW 6 58265966 nonsense probably null
R1464:Vmn1r28 UTSW 6 58265232 missense probably benign 0.05
R1464:Vmn1r28 UTSW 6 58265232 missense probably benign 0.05
R1836:Vmn1r28 UTSW 6 58265252 missense probably damaging 0.98
R1882:Vmn1r28 UTSW 6 58265978 missense probably benign
R1905:Vmn1r28 UTSW 6 58265927 missense probably benign 0.01
R4912:Vmn1r28 UTSW 6 58265540 missense possibly damaging 0.86
R5071:Vmn1r28 UTSW 6 58265909 missense probably benign 0.25
R5113:Vmn1r28 UTSW 6 58265858 missense probably benign 0.12
R5261:Vmn1r28 UTSW 6 58265539 missense probably benign 0.02
R5265:Vmn1r28 UTSW 6 58265964 missense probably damaging 0.98
R5839:Vmn1r28 UTSW 6 58265295 missense possibly damaging 0.94
R6180:Vmn1r28 UTSW 6 58265491 missense probably damaging 0.99
R6643:Vmn1r28 UTSW 6 58265960 missense probably benign 0.17
R6884:Vmn1r28 UTSW 6 58265648 missense probably benign 0.03
R7471:Vmn1r28 UTSW 6 58265865 nonsense probably null
R7738:Vmn1r28 UTSW 6 58266054 missense probably benign 0.00
R8009:Vmn1r28 UTSW 6 58265193 missense probably benign
Predicted Primers PCR Primer
(F):5'- AGGAGATAACTTGCTTGCAAAC -3'
(R):5'- GTGCTTGTGGTCAACATGAC -3'

Sequencing Primer
(F):5'- GTCACTAAAATTTGGGAATGACGTC -3'
(R):5'- CTTGTGGTCAACATGACTCCTACAAG -3'
Posted On2019-09-13