Incidental Mutation 'R7393:Cbl'
ID573605
Institutional Source Beutler Lab
Gene Symbol Cbl
Ensembl Gene ENSMUSG00000034342
Gene NameCasitas B-lineage lymphoma
SynonymsCbl-2, c-Cbl
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.722) question?
Stock #R7393 (G1)
Quality Score225.009
Status Not validated
Chromosome9
Chromosomal Location44142976-44234049 bp(-) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) A to G at 44154188 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000146244 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037644] [ENSMUST00000205968] [ENSMUST00000206147] [ENSMUST00000206720]
Predicted Effect probably null
Transcript: ENSMUST00000037644
SMART Domains Protein: ENSMUSP00000041902
Gene: ENSMUSG00000034342

DomainStartEndE-ValueType
low complexity region 8 23 N/A INTRINSIC
low complexity region 34 46 N/A INTRINSIC
Pfam:Cbl_N 49 173 9.4e-59 PFAM
Pfam:Cbl_N2 177 260 4.7e-44 PFAM
Pfam:Cbl_N3 262 347 7.2e-48 PFAM
RING 379 417 1.04e-7 SMART
low complexity region 454 463 N/A INTRINSIC
low complexity region 530 549 N/A INTRINSIC
UBA 864 901 3.17e-8 SMART
Predicted Effect probably null
Transcript: ENSMUST00000205968
Predicted Effect probably null
Transcript: ENSMUST00000206147
Predicted Effect probably null
Transcript: ENSMUST00000206258
Predicted Effect probably null
Transcript: ENSMUST00000206720
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a proto-oncogene that encodes a RING finger E3 ubiquitin ligase. The encoded protein is one of the enzymes required for targeting substrates for degradation by the proteasome. This protein mediates the transfer of ubiquitin from ubiquitin conjugating enzymes (E2) to specific substrates. This protein also contains an N-terminal phosphotyrosine binding domain that allows it to interact with numerous tyrosine-phosphorylated substrates and target them for proteasome degradation. As such it functions as a negative regulator of many signal transduction pathways. This gene has been found to be mutated or translocated in many cancers including acute myeloid leukaemia, and expansion of CGG repeats in the 5' UTR has been associated with Jacobsen syndrome. Mutations in this gene are also the cause of Noonan syndrome-like disorder. [provided by RefSeq, Jul 2016]
PHENOTYPE: Homozygotes for targeted null mutations exhibit increased thymic CD3 and CD4 expression and tyrosine-phosphorylation, lymphoid hyperplasia, and altered splenic hemopoiesis. Females show increased ductal density and branching in mammary fat pads. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010107E04Rik A G 12: 111,963,277 V26A probably benign Het
Abcb11 C T 2: 69,299,867 D282N probably damaging Het
Abi2 T C 1: 60,434,382 M86T possibly damaging Het
Adam26a T C 8: 43,569,688 N255S probably benign Het
Adam4 G A 12: 81,419,660 S729L probably benign Het
Adcy1 G T 11: 7,137,381 W418C probably damaging Het
Add2 T A 6: 86,098,647 Y259* probably null Het
Agl A T 3: 116,791,156 C172S probably benign Het
Ankfy1 A G 11: 72,738,308 T319A possibly damaging Het
Armc8 A T 9: 99,483,999 C621S possibly damaging Het
Bbc3 A G 7: 16,313,789 D146G probably benign Het
Btnl10 T C 11: 58,923,706 L404P probably damaging Het
Ccdc170 T A 10: 4,514,314 probably null Het
Ccdc91 T A 6: 147,534,029 V37E possibly damaging Het
Ces1e G T 8: 93,210,417 T343K probably benign Het
Chfr T A 5: 110,152,358 F323I probably damaging Het
Clcnkb T A 4: 141,409,445 M370L probably benign Het
Col11a1 A G 3: 114,097,106 D364G unknown Het
Ctbp2 A G 7: 132,988,292 I381T probably benign Het
Cyp4a29 A C 4: 115,242,196 Y38S probably damaging Het
Ddx1 T C 12: 13,230,353 D382G probably benign Het
Dhx57 T A 17: 80,255,571 N876Y probably damaging Het
Dsel C T 1: 111,861,573 G411S probably damaging Het
Enpp5 G A 17: 44,085,264 G356S probably damaging Het
Fam234a T C 17: 26,216,624 D262G probably benign Het
Fnbp4 C A 2: 90,779,316 Q1035K probably damaging Het
Gbp11 T A 5: 105,327,577 N302Y possibly damaging Het
Gm11554 T A 11: 99,803,872 T172S unknown Het
Hamp2 A T 7: 30,922,605 M53K possibly damaging Het
Kcnj1 A G 9: 32,397,018 D246G probably damaging Het
Kctd20 T C 17: 28,963,338 F209L probably damaging Het
Klra2 T C 6: 131,230,202 Y148C probably damaging Het
Krtap15 T C 16: 88,829,097 probably null Het
Mrps23 T C 11: 88,204,458 L6P probably damaging Het
Ms4a6d G A 19: 11,590,073 Q155* probably null Het
Myo7a G A 7: 98,063,699 R1690C possibly damaging Het
Nbas T C 12: 13,393,492 S1183P probably damaging Het
Ndufaf4 T A 4: 24,903,177 M122K probably benign Het
Nop2 C A 6: 125,133,546 S45* probably null Het
Nop56 T A 2: 130,274,638 L3Q probably benign Het
Nrp2 T C 1: 62,745,424 I244T probably damaging Het
Olfr1426 T A 19: 12,088,628 T55S probably benign Het
Olfr620 A G 7: 103,611,991 S121P possibly damaging Het
Otof T C 5: 30,370,270 D1941G probably benign Het
Pcyox1l T C 18: 61,697,641 K387E probably benign Het
Plcg2 A G 8: 117,579,825 Y306C possibly damaging Het
Ppp1r13b G A 12: 111,838,754 P333S probably damaging Het
Rcc2 A G 4: 140,717,030 D344G probably damaging Het
Reln A T 5: 21,976,351 N1810K probably damaging Het
Rfesd G T 13: 76,003,030 A90E probably benign Het
Rsf1 CGGCGGCGG CGGCGGCGGGGGCGGCGG 7: 97,579,917 probably benign Het
Scg2 T C 1: 79,435,231 K552E probably damaging Het
Sdccag8 A G 1: 176,840,306 I190V probably benign Het
Sele C A 1: 164,053,923 T533K probably benign Het
Sh3bp4 T A 1: 89,144,448 H339Q possibly damaging Het
Slc6a19 A G 13: 73,692,974 S106P probably benign Het
Spidr C T 16: 16,146,831 probably benign Het
Stk36 A T 1: 74,611,193 K295* probably null Het
Synj1 A T 16: 90,951,999 D1056E probably damaging Het
Tnks1bp1 T C 2: 85,062,866 S1046P probably benign Het
Ttc27 T G 17: 74,770,264 F385V possibly damaging Het
Ttn C A 2: 76,944,345 G2164W unknown Het
Ubap1 T A 4: 41,379,764 L326* probably null Het
Ubr4 A G 4: 139,426,785 N812S probably damaging Het
Vmn1r160 A G 7: 22,871,353 T44A possibly damaging Het
Vmn1r28 G A 6: 58,265,589 S139N possibly damaging Het
Vmn2r116 A G 17: 23,386,125 I137M probably benign Het
Vmn2r67 A T 7: 85,155,878 W9R probably null Het
Zfp101 T C 17: 33,386,700 N45D possibly damaging Het
Other mutations in Cbl
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00590:Cbl APN 9 44201198 missense probably damaging 1.00
IGL01369:Cbl APN 9 44201061 nonsense probably null
IGL01434:Cbl APN 9 44164206 missense probably damaging 0.99
IGL01866:Cbl APN 9 44153825 nonsense probably null
IGL02326:Cbl APN 9 44151473 missense possibly damaging 0.94
IGL02956:Cbl APN 9 44169034 missense probably damaging 1.00
Bungalow UTSW 9 44201119 missense probably damaging 1.00
Casita UTSW 9 44164165 missense probably damaging 1.00
tiny_house UTSW 9 44164152 missense probably damaging 1.00
R0068:Cbl UTSW 9 44154194 missense probably damaging 0.98
R0390:Cbl UTSW 9 44201005 missense probably damaging 1.00
R0655:Cbl UTSW 9 44158752 missense probably damaging 1.00
R0764:Cbl UTSW 9 44164152 missense probably damaging 1.00
R1466:Cbl UTSW 9 44154244 missense probably benign 0.10
R1466:Cbl UTSW 9 44154244 missense probably benign 0.10
R1616:Cbl UTSW 9 44152900 missense probably damaging 0.99
R1736:Cbl UTSW 9 44152895 missense possibly damaging 0.80
R1808:Cbl UTSW 9 44164229 missense probably damaging 1.00
R1865:Cbl UTSW 9 44164165 missense probably damaging 1.00
R3156:Cbl UTSW 9 44158850 missense possibly damaging 0.74
R3431:Cbl UTSW 9 44151446 makesense probably null
R4668:Cbl UTSW 9 44153848 missense probably benign 0.00
R4700:Cbl UTSW 9 44173380 missense probably damaging 1.00
R4866:Cbl UTSW 9 44152869 missense probably benign 0.00
R4900:Cbl UTSW 9 44152869 missense probably benign 0.00
R4995:Cbl UTSW 9 44153811 missense possibly damaging 0.62
R5014:Cbl UTSW 9 44154399 intron probably null
R5324:Cbl UTSW 9 44154254 missense probably damaging 0.97
R5353:Cbl UTSW 9 44173323 missense probably damaging 1.00
R5382:Cbl UTSW 9 44159021 missense probably benign
R5747:Cbl UTSW 9 44201119 missense probably damaging 1.00
R5834:Cbl UTSW 9 44233779 missense probably damaging 1.00
R6307:Cbl UTSW 9 44158512 critical splice donor site probably null
R6755:Cbl UTSW 9 44173374 missense probably damaging 0.98
R7779:Cbl UTSW 9 44159096 missense probably benign
R7789:Cbl UTSW 9 44163467 missense probably damaging 1.00
X0057:Cbl UTSW 9 44233767 small deletion probably benign
Predicted Primers PCR Primer
(F):5'- GTGCATGTTCTAGAGGCCTG -3'
(R):5'- CCATGGTCTGTGGAATGATAGTAC -3'

Sequencing Primer
(F):5'- TGTGCCACTGTGGAAACAAC -3'
(R):5'- TCATACTTGAAAGTTTTCCGGC -3'
Posted On2019-09-13