Incidental Mutation 'R7393:Spidr'
ID573620
Institutional Source Beutler Lab
Gene Symbol Spidr
Ensembl Gene ENSMUSG00000041974
Gene Namescaffolding protein involved in DNA repair
Synonyms2310008H04Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7393 (G1)
Quality Score225.009
Status Not validated
Chromosome16
Chromosomal Location15889224-16146851 bp(-) (GRCm38)
Type of Mutationstart gained
DNA Base Change (assembly) C to T at 16146831 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000038820 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040248]
Predicted Effect probably benign
Transcript: ENSMUST00000040248
SMART Domains Protein: ENSMUSP00000038820
Gene: ENSMUSG00000041974

DomainStartEndE-ValueType
Pfam:DUF4502 11 390 1.8e-177 PFAM
low complexity region 499 508 N/A INTRINSIC
Pfam:DUF4503 540 921 2.2e-179 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010107E04Rik A G 12: 111,963,277 V26A probably benign Het
Abcb11 C T 2: 69,299,867 D282N probably damaging Het
Abi2 T C 1: 60,434,382 M86T possibly damaging Het
Adam26a T C 8: 43,569,688 N255S probably benign Het
Adam4 G A 12: 81,419,660 S729L probably benign Het
Adcy1 G T 11: 7,137,381 W418C probably damaging Het
Add2 T A 6: 86,098,647 Y259* probably null Het
Agl A T 3: 116,791,156 C172S probably benign Het
Ankfy1 A G 11: 72,738,308 T319A possibly damaging Het
Armc8 A T 9: 99,483,999 C621S possibly damaging Het
Bbc3 A G 7: 16,313,789 D146G probably benign Het
Btnl10 T C 11: 58,923,706 L404P probably damaging Het
Cbl A G 9: 44,154,188 probably null Het
Ccdc170 T A 10: 4,514,314 probably null Het
Ccdc91 T A 6: 147,534,029 V37E possibly damaging Het
Ces1e G T 8: 93,210,417 T343K probably benign Het
Chfr T A 5: 110,152,358 F323I probably damaging Het
Clcnkb T A 4: 141,409,445 M370L probably benign Het
Col11a1 A G 3: 114,097,106 D364G unknown Het
Ctbp2 A G 7: 132,988,292 I381T probably benign Het
Cyp4a29 A C 4: 115,242,196 Y38S probably damaging Het
Ddx1 T C 12: 13,230,353 D382G probably benign Het
Dhx57 T A 17: 80,255,571 N876Y probably damaging Het
Dsel C T 1: 111,861,573 G411S probably damaging Het
Enpp5 G A 17: 44,085,264 G356S probably damaging Het
Fam234a T C 17: 26,216,624 D262G probably benign Het
Fnbp4 C A 2: 90,779,316 Q1035K probably damaging Het
Gbp11 T A 5: 105,327,577 N302Y possibly damaging Het
Gm11554 T A 11: 99,803,872 T172S unknown Het
Hamp2 A T 7: 30,922,605 M53K possibly damaging Het
Kcnj1 A G 9: 32,397,018 D246G probably damaging Het
Kctd20 T C 17: 28,963,338 F209L probably damaging Het
Klra2 T C 6: 131,230,202 Y148C probably damaging Het
Krtap15 T C 16: 88,829,097 probably null Het
Mrps23 T C 11: 88,204,458 L6P probably damaging Het
Ms4a6d G A 19: 11,590,073 Q155* probably null Het
Myo7a G A 7: 98,063,699 R1690C possibly damaging Het
Nbas T C 12: 13,393,492 S1183P probably damaging Het
Ndufaf4 T A 4: 24,903,177 M122K probably benign Het
Nop2 C A 6: 125,133,546 S45* probably null Het
Nop56 T A 2: 130,274,638 L3Q probably benign Het
Nrp2 T C 1: 62,745,424 I244T probably damaging Het
Olfr1426 T A 19: 12,088,628 T55S probably benign Het
Olfr620 A G 7: 103,611,991 S121P possibly damaging Het
Otof T C 5: 30,370,270 D1941G probably benign Het
Pcyox1l T C 18: 61,697,641 K387E probably benign Het
Plcg2 A G 8: 117,579,825 Y306C possibly damaging Het
Ppp1r13b G A 12: 111,838,754 P333S probably damaging Het
Rcc2 A G 4: 140,717,030 D344G probably damaging Het
Reln A T 5: 21,976,351 N1810K probably damaging Het
Rfesd G T 13: 76,003,030 A90E probably benign Het
Rsf1 CGGCGGCGG CGGCGGCGGGGGCGGCGG 7: 97,579,917 probably benign Het
Scg2 T C 1: 79,435,231 K552E probably damaging Het
Sdccag8 A G 1: 176,840,306 I190V probably benign Het
Sele C A 1: 164,053,923 T533K probably benign Het
Sh3bp4 T A 1: 89,144,448 H339Q possibly damaging Het
Slc6a19 A G 13: 73,692,974 S106P probably benign Het
Stk36 A T 1: 74,611,193 K295* probably null Het
Synj1 A T 16: 90,951,999 D1056E probably damaging Het
Tnks1bp1 T C 2: 85,062,866 S1046P probably benign Het
Ttc27 T G 17: 74,770,264 F385V possibly damaging Het
Ttn C A 2: 76,944,345 G2164W unknown Het
Ubap1 T A 4: 41,379,764 L326* probably null Het
Ubr4 A G 4: 139,426,785 N812S probably damaging Het
Vmn1r160 A G 7: 22,871,353 T44A possibly damaging Het
Vmn1r28 G A 6: 58,265,589 S139N possibly damaging Het
Vmn2r116 A G 17: 23,386,125 I137M probably benign Het
Vmn2r67 A T 7: 85,155,878 W9R probably null Het
Zfp101 T C 17: 33,386,700 N45D possibly damaging Het
Other mutations in Spidr
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00229:Spidr APN 16 15895578 missense probably damaging 1.00
IGL00482:Spidr APN 16 16114969 missense possibly damaging 0.94
IGL01760:Spidr APN 16 15912560 missense possibly damaging 0.71
IGL02142:Spidr APN 16 16048081 missense probably benign 0.25
IGL02392:Spidr APN 16 15889630 makesense probably null
IGL02430:Spidr APN 16 16114910 missense probably damaging 1.00
IGL03110:Spidr APN 16 15889754 missense probably damaging 1.00
R0011:Spidr UTSW 16 15966603 missense probably benign 0.00
R0504:Spidr UTSW 16 16140072 missense possibly damaging 0.73
R0505:Spidr UTSW 16 16037667 missense probably damaging 1.00
R0541:Spidr UTSW 16 15915365 missense probably damaging 1.00
R0675:Spidr UTSW 16 16037634 missense probably damaging 1.00
R0722:Spidr UTSW 16 15912781 missense probably damaging 1.00
R2005:Spidr UTSW 16 16048049 missense probably damaging 1.00
R2133:Spidr UTSW 16 16053273 missense probably benign 0.04
R2249:Spidr UTSW 16 16118923 missense probably damaging 1.00
R2876:Spidr UTSW 16 15912589 splice site probably null
R3087:Spidr UTSW 16 15968619 missense probably damaging 1.00
R3121:Spidr UTSW 16 16140860 missense probably damaging 1.00
R3765:Spidr UTSW 16 15968640 missense probably benign 0.39
R4896:Spidr UTSW 16 16118942 missense possibly damaging 0.70
R4939:Spidr UTSW 16 16140746 nonsense probably null
R5004:Spidr UTSW 16 16118942 missense possibly damaging 0.70
R5042:Spidr UTSW 16 16118903 missense probably benign 0.09
R5736:Spidr UTSW 16 15897298 missense probably damaging 1.00
R5839:Spidr UTSW 16 16037502 missense probably damaging 1.00
R5970:Spidr UTSW 16 16114869 missense probably damaging 1.00
R6084:Spidr UTSW 16 16140024 missense possibly damaging 0.87
R6386:Spidr UTSW 16 15968560 missense probably benign 0.02
R6572:Spidr UTSW 16 15912516 splice site probably null
R7238:Spidr UTSW 16 15966816 missense probably benign 0.10
R7249:Spidr UTSW 16 15966648 missense probably benign 0.00
R7334:Spidr UTSW 16 16114825 critical splice donor site probably null
R7681:Spidr UTSW 16 15895624 missense probably damaging 1.00
R7818:Spidr UTSW 16 16114865 missense probably damaging 1.00
R8247:Spidr UTSW 16 15968526 critical splice donor site probably null
R8507:Spidr UTSW 16 15968676 missense probably damaging 1.00
X0025:Spidr UTSW 16 15889752 missense probably benign
Predicted Primers PCR Primer
(F):5'- CTTGGTTCCCAGGACCATTCAG -3'
(R):5'- AGCTCTCAGGCTCCCTAAAGAG -3'

Sequencing Primer
(F):5'- AGGACCATTCAGCAGACCTGG -3'
(R):5'- CTCCCTAAAGAGCGAGAGGAAG -3'
Posted On2019-09-13