Incidental Mutation 'R7394:Snta1'
ID573640
Institutional Source Beutler Lab
Gene Symbol Snta1
Ensembl Gene ENSMUSG00000027488
Gene Namesyntrophin, acidic 1
Synonymsalpha1-syntrophin, Snt1
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.582) question?
Stock #R7394 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location154376313-154408099 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 154376860 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 490 (S490P)
Ref Sequence ENSEMBL: ENSMUSP00000028991 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028990] [ENSMUST00000028991] [ENSMUST00000109728] [ENSMUST00000109730] [ENSMUST00000109731]
PDB Structure Unexpected Modes of PDZ Domain Scaffolding Revealed by Structure of NNOS-Syntrophin Complex [X-RAY DIFFRACTION]
Solution structure of the PDZ domain of alpha-syntrophin [SOLUTION NMR]
solution structure of the split PH-PDZ Supramodule of alpha-Syntrophin [SOLUTION NMR]
solution structure of the joined PH domain of alpha1-syntrophin [SOLUTION NMR]
SOLUTION STRUCTURE OF THE SYNTROPHIN PDZ DOMAIN IN COMPLEX WITH THE PEPTIDE GVKESLV, NMR, 15 STRUCTURES [SOLUTION NMR]
Crystal structure of the computationally designed NNOS-Syntrophin complex [X-RAY DIFFRACTION]
Predicted Effect probably benign
Transcript: ENSMUST00000028990
SMART Domains Protein: ENSMUSP00000028990
Gene: ENSMUSG00000027487

DomainStartEndE-ValueType
Pfam:UPF0004 100 203 3.2e-31 PFAM
Elp3 247 486 4.83e-52 SMART
Pfam:TRAM 500 574 1.2e-11 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000028991
AA Change: S490P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000028991
Gene: ENSMUSG00000027488
AA Change: S490P

DomainStartEndE-ValueType
PH 7 265 1.24e0 SMART
PDZ 90 164 1.88e-19 SMART
PH 288 401 1.4e-3 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000109728
AA Change: S486P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000105350
Gene: ENSMUSG00000027488
AA Change: S486P

DomainStartEndE-ValueType
PH 7 265 1.24e0 SMART
PDZ 90 164 1.88e-19 SMART
PH 288 397 1.63e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000109730
SMART Domains Protein: ENSMUSP00000105352
Gene: ENSMUSG00000027487

DomainStartEndE-ValueType
Pfam:UPF0004 100 181 1.3e-24 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000109731
SMART Domains Protein: ENSMUSP00000105353
Gene: ENSMUSG00000027487

DomainStartEndE-ValueType
Pfam:UPF0004 100 203 1.1e-31 PFAM
Elp3 247 486 4.83e-52 SMART
Pfam:TRAM 500 574 1e-12 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 99% (66/67)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Syntrophins are cytoplasmic peripheral membrane scaffold proteins that are components of the dystrophin-associated protein complex. This gene is a member of the syntrophin gene family and encodes the most common syntrophin isoform found in cardiac tissues. The N-terminal PDZ domain of this syntrophin protein interacts with the C-terminus of the pore-forming alpha subunit (SCN5A) of the cardiac sodium channel Nav1.5. This protein also associates cardiac sodium channels with the nitric oxide synthase-PMCA4b (plasma membrane Ca-ATPase subtype 4b) complex in cardiomyocytes. This gene is a susceptibility locus for Long-QT syndrome (LQT) - an inherited disorder associated with sudden cardiac death from arrhythmia - and sudden infant death syndrome (SIDS). This protein also associates with dystrophin and dystrophin-related proteins at the neuromuscular junction and alters intracellular calcium ion levels in muscle tissue. [provided by RefSeq, Jan 2013]
PHENOTYPE: Mice homozygous for a targeted null allele display impaired astrocyte and neuromuscular synapse morphology. Mice homozygous for another targeted null allele show neither gross histological abnormalities in skeletal muscle nor significant changes in muscle contractile properties. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700017N19Rik A G 10: 100,609,176 I208V probably benign Het
Abcb11 C T 2: 69,299,867 D282N probably damaging Het
Aldh1l2 T A 10: 83,502,457 I646F probably damaging Het
Alms1 C T 6: 85,622,223 P1344S possibly damaging Het
Ank2 T A 3: 126,936,653 I711L possibly damaging Het
Ankrd6 T C 4: 32,821,298 N251D probably damaging Het
Ap3m1 T C 14: 21,038,079 T304A probably benign Het
Arhgef39 T C 4: 43,499,532 T26A possibly damaging Het
C530008M17Rik GCGCGAGGCCGAGAGGCAGGAGGAGGAAGCAAGACAACGCGAGGCCGAGAGGCAGG GCGCGAGGCCGAGAGGCAGG 5: 76,856,954 probably benign Het
Carnmt1 G T 19: 18,670,837 probably benign Het
Ccr4 C T 9: 114,491,926 R357H probably benign Het
Cd4 T A 6: 124,873,041 M104L probably benign Het
Cd74 A T 18: 60,803,893 probably benign Het
Cdcp1 T C 9: 123,173,813 Y731C probably damaging Het
Cdyl2 A G 8: 116,624,051 S114P not run Het
Cenpv T C 11: 62,536,288 D148G probably damaging Het
Cep89 G A 7: 35,429,928 R630H probably damaging Het
Cfap57 T A 4: 118,593,137 Y596F probably benign Het
Clec4a2 C A 6: 123,139,120 A122E unknown Het
Col4a2 A G 8: 11,446,184 T1602A probably benign Het
Cyp2j11 A T 4: 96,316,440 Y290N probably benign Het
Dhx38 A T 8: 109,556,523 V554E probably damaging Het
Ebf2 T C 14: 67,237,526 V70A probably damaging Het
Enpp5 G A 17: 44,085,264 G356S probably damaging Het
Fam217a A T 13: 34,910,279 I499K possibly damaging Het
Fras1 C A 5: 96,712,450 Y2118* probably null Het
Gm3248 A T 14: 5,945,781 probably null Het
Gm5460 T G 14: 34,043,922 D165E possibly damaging Het
Grk4 A T 5: 34,751,618 N490Y probably benign Het
Iglc2 T A 16: 19,195,136 K59* probably null Het
Iqsec3 T A 6: 121,386,610 H895L possibly damaging Het
Itgb7 A G 15: 102,219,254 S410P probably damaging Het
Kmt2d C A 15: 98,856,384 V1613F unknown Het
Lama1 T C 17: 67,717,261 L118P Het
Lrrc25 A T 8: 70,618,180 S204C possibly damaging Het
Malrd1 A G 2: 15,695,199 D619G unknown Het
Ms4a6d G A 19: 11,590,073 Q155* probably null Het
Mup17 G A 4: 61,594,398 S86F probably benign Het
Nbeal2 C T 9: 110,630,189 probably null Het
Nfkb1 A C 3: 135,613,697 V291G possibly damaging Het
Nomo1 G T 7: 46,066,479 V757F probably benign Het
Nutm2 T A 13: 50,470,007 S247T probably damaging Het
Olfr1225 C T 2: 89,170,361 V284I probably benign Het
Olfr1291-ps1 G T 2: 111,499,896 A215S probably damaging Het
Olfr521 C A 7: 99,767,346 H61Q probably damaging Het
Olfr826 T A 10: 130,180,254 I209F probably damaging Het
Olfr834 T A 9: 18,988,710 C241S probably damaging Het
Pcdhb14 A G 18: 37,448,908 I356V probably benign Het
Pnkp T A 7: 44,858,678 S142T probably damaging Het
Ppia T C 11: 6,419,218 S99P possibly damaging Het
Prss47 C T 13: 65,044,993 V325I probably benign Het
Ptk7 T C 17: 46,591,757 D34G probably damaging Het
Pwp2 C T 10: 78,182,480 G126R probably damaging Het
Rasa3 G T 8: 13,595,353 D195E probably benign Het
Rnf150 T A 8: 82,990,471 Y202* probably null Het
Sh2d1b2 T C 1: 170,248,147 V50A probably damaging Het
Slc30a4 C T 2: 122,685,304 V390I possibly damaging Het
Slc30a9 G T 5: 67,352,766 probably null Het
Slc8a3 T A 12: 81,214,058 probably null Het
Smpd3 G A 8: 106,265,010 R304W probably damaging Het
Srcap T G 7: 127,534,828 M887R probably damaging Het
St3gal1 A G 15: 67,111,346 V187A possibly damaging Het
Sult2a3 T C 7: 14,111,524 T137A probably benign Het
Tspoap1 C T 11: 87,766,119 Q367* probably null Het
Uroc1 C T 6: 90,345,333 R280C probably damaging Het
Ush2a T C 1: 188,911,416 I4325T possibly damaging Het
Vmn1r32 A G 6: 66,553,189 I201T probably benign Het
Zadh2 C T 18: 84,088,190 A9V probably benign Het
Zfp651 T A 9: 121,767,345 M626K probably damaging Het
Other mutations in Snta1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02928:Snta1 APN 2 154381039 missense probably benign
R0080:Snta1 UTSW 2 154383837 missense probably benign 0.02
R0631:Snta1 UTSW 2 154377072 missense probably benign 0.00
R0760:Snta1 UTSW 2 154380940 missense probably damaging 0.97
R1545:Snta1 UTSW 2 154377006 critical splice donor site probably null
R4584:Snta1 UTSW 2 154378115 missense probably benign 0.00
R4910:Snta1 UTSW 2 154377018 nonsense probably null
R5330:Snta1 UTSW 2 154378020 nonsense probably null
R6180:Snta1 UTSW 2 154377182 missense probably benign 0.03
R6414:Snta1 UTSW 2 154378067 missense possibly damaging 0.80
R6468:Snta1 UTSW 2 154377149 missense probably damaging 0.99
R7070:Snta1 UTSW 2 154381059 missense probably benign
R7857:Snta1 UTSW 2 154383897 missense probably benign 0.00
R8153:Snta1 UTSW 2 154380802 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- TGTCCCAGGTCTGAGTTCTG -3'
(R):5'- GATGGCACGAGTCTCCTTTTC -3'

Sequencing Primer
(F):5'- TCCTCAGGCTGGTCTCTGAG -3'
(R):5'- ACGAGTCTCCTTTTCCTGGAC -3'
Posted On2019-09-13