Incidental Mutation 'R7394:Nfkb1'
ID573642
Institutional Source Beutler Lab
Gene Symbol Nfkb1
Ensembl Gene ENSMUSG00000028163
Gene Namenuclear factor of kappa light polypeptide gene enhancer in B cells 1, p105
Synonymsp50 subunit of NF kappaB, nuclear factor kappaB p50, NF-kappaB, NF-kappaB p50, p50, p50/p105, NF kappaB1
MMRRC Submission
Accession Numbers

Ncbi RefSeq: NM_008689.2; MGI: 97312

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7394 (G1)
Quality Score225.009
Status Validated
Chromosome3
Chromosomal Location135584655-135691547 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 135613697 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glycine at position 291 (V291G)
Ref Sequence ENSEMBL: ENSMUSP00000029812 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029812] [ENSMUST00000164430] [ENSMUST00000196469]
Predicted Effect possibly damaging
Transcript: ENSMUST00000029812
AA Change: V291G

PolyPhen 2 Score 0.541 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000029812
Gene: ENSMUSG00000028163
AA Change: V291G

DomainStartEndE-ValueType
Pfam:RHD 42 240 2.9e-75 PFAM
IPT 247 348 1.14e-22 SMART
low complexity region 368 414 N/A INTRINSIC
ANK 538 568 2.27e1 SMART
ANK 577 606 1.11e-2 SMART
ANK 610 640 2.47e0 SMART
ANK 646 675 5.53e-3 SMART
ANK 680 710 1.9e-1 SMART
ANK 714 743 2.18e-1 SMART
DEATH 801 888 1.9e-19 SMART
low complexity region 890 902 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000164430
AA Change: V291G

PolyPhen 2 Score 0.541 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000128345
Gene: ENSMUSG00000028163
AA Change: V291G

DomainStartEndE-ValueType
Pfam:RHD_DNA_bind 42 240 2.9e-75 PFAM
IPT 247 348 1.14e-22 SMART
low complexity region 368 414 N/A INTRINSIC
ANK 538 568 2.27e1 SMART
ANK 577 606 1.11e-2 SMART
ANK 610 640 2.47e0 SMART
ANK 646 675 5.53e-3 SMART
ANK 680 710 1.9e-1 SMART
ANK 714 743 2.18e-1 SMART
DEATH 801 888 1.9e-19 SMART
low complexity region 890 902 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000196469
SMART Domains Protein: ENSMUSP00000143601
Gene: ENSMUSG00000028163

DomainStartEndE-ValueType
Pfam:RHD_DNA_bind 42 90 2.5e-19 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 99% (66/67)
MGI Phenotype Strain: 1857225
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a 105 kD protein which can undergo cotranslational processing by the 26S proteasome to produce a 50 kD protein. The 105 kD protein is a Rel protein-specific transcription inhibitor and the 50 kD protein is a DNA binding subunit of the NF-kappa-B (NFKB) protein complex. NFKB is a transcription regulator that is activated by various intra- and extra-cellular stimuli such as cytokines, oxidant-free radicals, ultraviolet irradiation, and bacterial or viral products. Activated NFKB translocates into the nucleus and stimulates the expression of genes involved in a wide variety of biological functions. Inappropriate activation of NFKB has been associated with a number of inflammatory diseases while persistent inhibition of NFKB leads to inappropriate immune cell development or delayed cell growth. Alternative splicing results in multiple transcript variants encoding different isoforms, at least one of which is proteolytically processed. [provided by RefSeq, Feb 2016]
PHENOTYPE: Homozygous null mice have a decreased survivor rate, abnormal T cell development and decreased number of peripheral T cells, abnormal humoral responses with decreased immunoglobulin class switching, exhibit mild organ inflammation, and are susceptible toboth bacterial infections and hearing loss. [provided by MGI curators]
Allele List at MGI

All alleles(79) : Targeted(5) Gene trapped(74)

Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700017N19Rik A G 10: 100,609,176 I208V probably benign Het
Abcb11 C T 2: 69,299,867 D282N probably damaging Het
Aldh1l2 T A 10: 83,502,457 I646F probably damaging Het
Alms1 C T 6: 85,622,223 P1344S possibly damaging Het
Ank2 T A 3: 126,936,653 I711L possibly damaging Het
Ankrd6 T C 4: 32,821,298 N251D probably damaging Het
Ap3m1 T C 14: 21,038,079 T304A probably benign Het
Arhgef39 T C 4: 43,499,532 T26A possibly damaging Het
C530008M17Rik GCGCGAGGCCGAGAGGCAGGAGGAGGAAGCAAGACAACGCGAGGCCGAGAGGCAGG GCGCGAGGCCGAGAGGCAGG 5: 76,856,954 probably benign Het
Carnmt1 G T 19: 18,670,837 probably benign Het
Ccr4 C T 9: 114,491,926 R357H probably benign Het
Cd4 T A 6: 124,873,041 M104L probably benign Het
Cd74 A T 18: 60,803,893 probably benign Het
Cdcp1 T C 9: 123,173,813 Y731C probably damaging Het
Cdyl2 A G 8: 116,624,051 S114P not run Het
Cenpv T C 11: 62,536,288 D148G probably damaging Het
Cep89 G A 7: 35,429,928 R630H probably damaging Het
Cfap57 T A 4: 118,593,137 Y596F probably benign Het
Clec4a2 C A 6: 123,139,120 A122E unknown Het
Col4a2 A G 8: 11,446,184 T1602A probably benign Het
Cyp2j11 A T 4: 96,316,440 Y290N probably benign Het
Dhx38 A T 8: 109,556,523 V554E probably damaging Het
Ebf2 T C 14: 67,237,526 V70A probably damaging Het
Enpp5 G A 17: 44,085,264 G356S probably damaging Het
Fam217a A T 13: 34,910,279 I499K possibly damaging Het
Fras1 C A 5: 96,712,450 Y2118* probably null Het
Gm3248 A T 14: 5,945,781 probably null Het
Gm5460 T G 14: 34,043,922 D165E possibly damaging Het
Grk4 A T 5: 34,751,618 N490Y probably benign Het
Iglc2 T A 16: 19,195,136 K59* probably null Het
Iqsec3 T A 6: 121,386,610 H895L possibly damaging Het
Itgb7 A G 15: 102,219,254 S410P probably damaging Het
Kmt2d C A 15: 98,856,384 V1613F unknown Het
Lama1 T C 17: 67,717,261 L118P Het
Lrrc25 A T 8: 70,618,180 S204C possibly damaging Het
Malrd1 A G 2: 15,695,199 D619G unknown Het
Ms4a6d G A 19: 11,590,073 Q155* probably null Het
Mup17 G A 4: 61,594,398 S86F probably benign Het
Nbeal2 C T 9: 110,630,189 probably null Het
Nomo1 G T 7: 46,066,479 V757F probably benign Het
Nutm2 T A 13: 50,470,007 S247T probably damaging Het
Olfr1225 C T 2: 89,170,361 V284I probably benign Het
Olfr1291-ps1 G T 2: 111,499,896 A215S probably damaging Het
Olfr521 C A 7: 99,767,346 H61Q probably damaging Het
Olfr826 T A 10: 130,180,254 I209F probably damaging Het
Olfr834 T A 9: 18,988,710 C241S probably damaging Het
Pcdhb14 A G 18: 37,448,908 I356V probably benign Het
Pnkp T A 7: 44,858,678 S142T probably damaging Het
Ppia T C 11: 6,419,218 S99P possibly damaging Het
Prss47 C T 13: 65,044,993 V325I probably benign Het
Ptk7 T C 17: 46,591,757 D34G probably damaging Het
Pwp2 C T 10: 78,182,480 G126R probably damaging Het
Rasa3 G T 8: 13,595,353 D195E probably benign Het
Rnf150 T A 8: 82,990,471 Y202* probably null Het
Sh2d1b2 T C 1: 170,248,147 V50A probably damaging Het
Slc30a4 C T 2: 122,685,304 V390I possibly damaging Het
Slc30a9 G T 5: 67,352,766 probably null Het
Slc8a3 T A 12: 81,214,058 probably null Het
Smpd3 G A 8: 106,265,010 R304W probably damaging Het
Snta1 A G 2: 154,376,860 S490P probably damaging Het
Srcap T G 7: 127,534,828 M887R probably damaging Het
St3gal1 A G 15: 67,111,346 V187A possibly damaging Het
Sult2a3 T C 7: 14,111,524 T137A probably benign Het
Tspoap1 C T 11: 87,766,119 Q367* probably null Het
Uroc1 C T 6: 90,345,333 R280C probably damaging Het
Ush2a T C 1: 188,911,416 I4325T possibly damaging Het
Vmn1r32 A G 6: 66,553,189 I201T probably benign Het
Zadh2 C T 18: 84,088,190 A9V probably benign Het
Zfp651 T A 9: 121,767,345 M626K probably damaging Het
Other mutations in Nfkb1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01293:Nfkb1 APN 3 135590839 missense probably damaging 1.00
IGL01345:Nfkb1 APN 3 135594981 missense probably damaging 1.00
IGL01629:Nfkb1 APN 3 135601467 missense probably benign
IGL02216:Nfkb1 APN 3 135594963 missense probably damaging 0.98
IGL02273:Nfkb1 APN 3 135605207 missense probably benign 0.01
IGL02508:Nfkb1 APN 3 135590818 missense probably damaging 0.99
IGL03095:Nfkb1 APN 3 135618830 missense possibly damaging 0.48
Conversely UTSW 3 135626659 missense probably damaging 1.00
Finlay UTSW 3 135595053 nonsense probably null
Frisbee UTSW 3 135613943 missense possibly damaging 0.93
kookaburra UTSW 3 135626611 nonsense probably null
Murgatroyd UTSW 3 135626710 missense possibly damaging 0.72
Poderoso UTSW 3 135613990 missense probably damaging 1.00
Puff UTSW 3 135595053 nonsense probably null
Roomba UTSW 3 135612412 critical splice donor site probably null
Wheelo UTSW 3 135615349 missense possibly damaging 0.81
R0026:Nfkb1 UTSW 3 135591573 missense probably damaging 1.00
R0047:Nfkb1 UTSW 3 135595053 nonsense probably null
R0989:Nfkb1 UTSW 3 135589396 missense probably benign 0.00
R1210:Nfkb1 UTSW 3 135594927 missense probably benign 0.03
R1661:Nfkb1 UTSW 3 135594957 missense probably damaging 1.00
R1665:Nfkb1 UTSW 3 135594957 missense probably damaging 1.00
R1725:Nfkb1 UTSW 3 135667758 missense probably damaging 1.00
R1984:Nfkb1 UTSW 3 135615349 missense possibly damaging 0.81
R1985:Nfkb1 UTSW 3 135615349 missense possibly damaging 0.81
R2154:Nfkb1 UTSW 3 135601479 missense probably benign 0.44
R2281:Nfkb1 UTSW 3 135601521 missense probably damaging 1.00
R2409:Nfkb1 UTSW 3 135613943 missense possibly damaging 0.93
R2504:Nfkb1 UTSW 3 135589329 missense possibly damaging 0.51
R4032:Nfkb1 UTSW 3 135594349 missense possibly damaging 0.63
R4232:Nfkb1 UTSW 3 135603770 missense probably damaging 1.00
R4936:Nfkb1 UTSW 3 135613982 missense probably damaging 0.97
R5085:Nfkb1 UTSW 3 135603807 missense probably benign 0.36
R5262:Nfkb1 UTSW 3 135612412 critical splice donor site probably null
R5384:Nfkb1 UTSW 3 135612542 missense possibly damaging 0.95
R5385:Nfkb1 UTSW 3 135612542 missense possibly damaging 0.95
R5434:Nfkb1 UTSW 3 135626611 nonsense probably null
R5663:Nfkb1 UTSW 3 135603851 missense possibly damaging 0.88
R5865:Nfkb1 UTSW 3 135603780 missense probably damaging 1.00
R6006:Nfkb1 UTSW 3 135603761 nonsense probably null
R6013:Nfkb1 UTSW 3 135626684 missense possibly damaging 0.86
R6234:Nfkb1 UTSW 3 135626710 missense possibly damaging 0.72
R6785:Nfkb1 UTSW 3 135615303 missense probably benign
R7175:Nfkb1 UTSW 3 135613990 missense probably damaging 1.00
R7227:Nfkb1 UTSW 3 135626659 missense probably damaging 1.00
R7727:Nfkb1 UTSW 3 135585401 missense possibly damaging 0.48
R7815:Nfkb1 UTSW 3 135603791 missense probably damaging 1.00
R7849:Nfkb1 UTSW 3 135585412 missense
R8004:Nfkb1 UTSW 3 135591551 splice site probably benign
R8059:Nfkb1 UTSW 3 135593852 missense possibly damaging 0.54
X0050:Nfkb1 UTSW 3 135606623 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATGTCAGAGTACTGGAAGAGCC -3'
(R):5'- ACGTACACACCTGGTCTCTAG -3'

Sequencing Primer
(F):5'- GAGCCATAAACATAGCATTGCTG -3'
(R):5'- ACACACCTGGTCTCTAGATGTAGG -3'
Posted On2019-09-13