Incidental Mutation 'R7394:Arhgef39'
ID573644
Institutional Source Beutler Lab
Gene Symbol Arhgef39
Ensembl Gene ENSMUSG00000051517
Gene NameRho guanine nucleotide exchange factor (GEF) 39
SynonymsE130306D19Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.086) question?
Stock #R7394 (G1)
Quality Score225.009
Status Validated
Chromosome4
Chromosomal Location43496142-43499695 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 43499532 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 26 (T26A)
Ref Sequence ENSEMBL: ENSMUSP00000055293 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030181] [ENSMUST00000054538] [ENSMUST00000107922]
Predicted Effect probably benign
Transcript: ENSMUST00000030181
SMART Domains Protein: ENSMUSP00000030181
Gene: ENSMUSG00000028461

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
coiled coil region 97 132 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000054538
AA Change: T26A

PolyPhen 2 Score 0.900 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000055293
Gene: ENSMUSG00000051517
AA Change: T26A

DomainStartEndE-ValueType
RhoGEF 26 196 4.92e-31 SMART
PH 228 333 5.71e-9 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000107922
SMART Domains Protein: ENSMUSP00000103555
Gene: ENSMUSG00000028461

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
coiled coil region 97 132 N/A INTRINSIC
Predicted Effect silent
Transcript: ENSMUST00000136005
SMART Domains Protein: ENSMUSP00000118144
Gene: ENSMUSG00000051517

DomainStartEndE-ValueType
Pfam:RhoGEF 53 153 2.5e-18 PFAM
PH 154 256 1.97e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000152134
SMART Domains Protein: ENSMUSP00000119911
Gene: ENSMUSG00000051517

DomainStartEndE-ValueType
Blast:PH 2 82 7e-38 BLAST
SCOP:d1kz7a2 2 88 4e-6 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 99% (66/67)
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700017N19Rik A G 10: 100,609,176 I208V probably benign Het
Abcb11 C T 2: 69,299,867 D282N probably damaging Het
Aldh1l2 T A 10: 83,502,457 I646F probably damaging Het
Alms1 C T 6: 85,622,223 P1344S possibly damaging Het
Ank2 T A 3: 126,936,653 I711L possibly damaging Het
Ankrd6 T C 4: 32,821,298 N251D probably damaging Het
Ap3m1 T C 14: 21,038,079 T304A probably benign Het
C530008M17Rik GCGCGAGGCCGAGAGGCAGGAGGAGGAAGCAAGACAACGCGAGGCCGAGAGGCAGG GCGCGAGGCCGAGAGGCAGG 5: 76,856,954 probably benign Het
Carnmt1 G T 19: 18,670,837 probably benign Het
Ccr4 C T 9: 114,491,926 R357H probably benign Het
Cd4 T A 6: 124,873,041 M104L probably benign Het
Cd74 A T 18: 60,803,893 probably benign Het
Cdcp1 T C 9: 123,173,813 Y731C probably damaging Het
Cdyl2 A G 8: 116,624,051 S114P not run Het
Cenpv T C 11: 62,536,288 D148G probably damaging Het
Cep89 G A 7: 35,429,928 R630H probably damaging Het
Cfap57 T A 4: 118,593,137 Y596F probably benign Het
Clec4a2 C A 6: 123,139,120 A122E unknown Het
Col4a2 A G 8: 11,446,184 T1602A probably benign Het
Cyp2j11 A T 4: 96,316,440 Y290N probably benign Het
Dhx38 A T 8: 109,556,523 V554E probably damaging Het
Ebf2 T C 14: 67,237,526 V70A probably damaging Het
Enpp5 G A 17: 44,085,264 G356S probably damaging Het
Fam217a A T 13: 34,910,279 I499K possibly damaging Het
Fras1 C A 5: 96,712,450 Y2118* probably null Het
Gm3248 A T 14: 5,945,781 probably null Het
Gm5460 T G 14: 34,043,922 D165E possibly damaging Het
Grk4 A T 5: 34,751,618 N490Y probably benign Het
Iglc2 T A 16: 19,195,136 K59* probably null Het
Iqsec3 T A 6: 121,386,610 H895L possibly damaging Het
Itgb7 A G 15: 102,219,254 S410P probably damaging Het
Kmt2d C A 15: 98,856,384 V1613F unknown Het
Lama1 T C 17: 67,717,261 L118P Het
Lrrc25 A T 8: 70,618,180 S204C possibly damaging Het
Malrd1 A G 2: 15,695,199 D619G unknown Het
Ms4a6d G A 19: 11,590,073 Q155* probably null Het
Mup17 G A 4: 61,594,398 S86F probably benign Het
Nbeal2 C T 9: 110,630,189 probably null Het
Nfkb1 A C 3: 135,613,697 V291G possibly damaging Het
Nomo1 G T 7: 46,066,479 V757F probably benign Het
Nutm2 T A 13: 50,470,007 S247T probably damaging Het
Olfr1225 C T 2: 89,170,361 V284I probably benign Het
Olfr1291-ps1 G T 2: 111,499,896 A215S probably damaging Het
Olfr521 C A 7: 99,767,346 H61Q probably damaging Het
Olfr826 T A 10: 130,180,254 I209F probably damaging Het
Olfr834 T A 9: 18,988,710 C241S probably damaging Het
Pcdhb14 A G 18: 37,448,908 I356V probably benign Het
Pnkp T A 7: 44,858,678 S142T probably damaging Het
Ppia T C 11: 6,419,218 S99P possibly damaging Het
Prss47 C T 13: 65,044,993 V325I probably benign Het
Ptk7 T C 17: 46,591,757 D34G probably damaging Het
Pwp2 C T 10: 78,182,480 G126R probably damaging Het
Rasa3 G T 8: 13,595,353 D195E probably benign Het
Rnf150 T A 8: 82,990,471 Y202* probably null Het
Sh2d1b2 T C 1: 170,248,147 V50A probably damaging Het
Slc30a4 C T 2: 122,685,304 V390I possibly damaging Het
Slc30a9 G T 5: 67,352,766 probably null Het
Slc8a3 T A 12: 81,214,058 probably null Het
Smpd3 G A 8: 106,265,010 R304W probably damaging Het
Snta1 A G 2: 154,376,860 S490P probably damaging Het
Srcap T G 7: 127,534,828 M887R probably damaging Het
St3gal1 A G 15: 67,111,346 V187A possibly damaging Het
Sult2a3 T C 7: 14,111,524 T137A probably benign Het
Tspoap1 C T 11: 87,766,119 Q367* probably null Het
Uroc1 C T 6: 90,345,333 R280C probably damaging Het
Ush2a T C 1: 188,911,416 I4325T possibly damaging Het
Vmn1r32 A G 6: 66,553,189 I201T probably benign Het
Zadh2 C T 18: 84,088,190 A9V probably benign Het
Zfp651 T A 9: 121,767,345 M626K probably damaging Het
Other mutations in Arhgef39
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01014:Arhgef39 APN 4 43499502 missense probably damaging 1.00
IGL01674:Arhgef39 APN 4 43497590 missense probably damaging 0.98
IGL02134:Arhgef39 APN 4 43497578 splice site probably null
kidd UTSW 4 43498913 missense possibly damaging 0.55
teach UTSW 4 43498999 missense probably damaging 1.00
R0384:Arhgef39 UTSW 4 43498613 missense probably damaging 1.00
R0781:Arhgef39 UTSW 4 43496834 missense probably benign 0.00
R1110:Arhgef39 UTSW 4 43496834 missense probably benign 0.00
R1957:Arhgef39 UTSW 4 43499309 missense probably damaging 1.00
R1966:Arhgef39 UTSW 4 43496710 missense probably benign 0.00
R3087:Arhgef39 UTSW 4 43497581 critical splice donor site probably null
R4289:Arhgef39 UTSW 4 43497353 unclassified probably benign
R4426:Arhgef39 UTSW 4 43497112 missense possibly damaging 0.53
R6481:Arhgef39 UTSW 4 43498580 splice site probably null
R7105:Arhgef39 UTSW 4 43498913 missense possibly damaging 0.55
R8187:Arhgef39 UTSW 4 43498999 missense probably damaging 1.00
R8474:Arhgef39 UTSW 4 43498015 missense probably benign 0.00
R8700:Arhgef39 UTSW 4 43496715 missense probably benign
Predicted Primers PCR Primer
(F):5'- TTTGGCTTTCAGGATCCGC -3'
(R):5'- GATGCTACTACACCTGGGACTC -3'

Sequencing Primer
(F):5'- AAGCAAGGTCTTTGACCC -3'
(R):5'- ATGCTCTATGCTGCGCG -3'
Posted On2019-09-13