Incidental Mutation 'R7394:Uroc1'
ID573654
Institutional Source Beutler Lab
Gene Symbol Uroc1
Ensembl Gene ENSMUSG00000034456
Gene Nameurocanase domain containing 1
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7394 (G1)
Quality Score225.009
Status Validated
Chromosome6
Chromosomal Location90333284-90364551 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 90345333 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Cysteine at position 280 (R280C)
Ref Sequence ENSEMBL: ENSMUSP00000127114 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046128] [ENSMUST00000164761]
Predicted Effect probably damaging
Transcript: ENSMUST00000046128
AA Change: R280C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000040424
Gene: ENSMUSG00000034456
AA Change: R280C

DomainStartEndE-ValueType
Pfam:Urocanase 84 662 2.7e-231 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000164761
AA Change: R280C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000127114
Gene: ENSMUSG00000034456
AA Change: R280C

DomainStartEndE-ValueType
Pfam:Urocanase 85 316 1.4e-102 PFAM
Pfam:Urocanase 319 683 8.7e-144 PFAM
Meta Mutation Damage Score 0.5135 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 99% (66/67)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an enzyme involved in histidine catabolism, metabolizing urocanic acid to formiminoglutamic acid. The gene product is known to protect the skin from ultra violet rays and is contained in human sweat. Deficiency of this gene product in the liver is an apparent cause of mental retardation. Multiple transcript variants encoding different isoforms have been found for this gene.[provided by RefSeq, Sep 2009]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700017N19Rik A G 10: 100,609,176 I208V probably benign Het
Abcb11 C T 2: 69,299,867 D282N probably damaging Het
Aldh1l2 T A 10: 83,502,457 I646F probably damaging Het
Alms1 C T 6: 85,622,223 P1344S possibly damaging Het
Ank2 T A 3: 126,936,653 I711L possibly damaging Het
Ankrd6 T C 4: 32,821,298 N251D probably damaging Het
Ap3m1 T C 14: 21,038,079 T304A probably benign Het
Arhgef39 T C 4: 43,499,532 T26A possibly damaging Het
C530008M17Rik GCGCGAGGCCGAGAGGCAGGAGGAGGAAGCAAGACAACGCGAGGCCGAGAGGCAGG GCGCGAGGCCGAGAGGCAGG 5: 76,856,954 probably benign Het
Carnmt1 G T 19: 18,670,837 probably benign Het
Ccr4 C T 9: 114,491,926 R357H probably benign Het
Cd4 T A 6: 124,873,041 M104L probably benign Het
Cd74 A T 18: 60,803,893 probably benign Het
Cdcp1 T C 9: 123,173,813 Y731C probably damaging Het
Cdyl2 A G 8: 116,624,051 S114P not run Het
Cenpv T C 11: 62,536,288 D148G probably damaging Het
Cep89 G A 7: 35,429,928 R630H probably damaging Het
Cfap57 T A 4: 118,593,137 Y596F probably benign Het
Clec4a2 C A 6: 123,139,120 A122E unknown Het
Col4a2 A G 8: 11,446,184 T1602A probably benign Het
Cyp2j11 A T 4: 96,316,440 Y290N probably benign Het
Dhx38 A T 8: 109,556,523 V554E probably damaging Het
Ebf2 T C 14: 67,237,526 V70A probably damaging Het
Enpp5 G A 17: 44,085,264 G356S probably damaging Het
Fam217a A T 13: 34,910,279 I499K possibly damaging Het
Fras1 C A 5: 96,712,450 Y2118* probably null Het
Gm3248 A T 14: 5,945,781 probably null Het
Gm5460 T G 14: 34,043,922 D165E possibly damaging Het
Grk4 A T 5: 34,751,618 N490Y probably benign Het
Iglc2 T A 16: 19,195,136 K59* probably null Het
Iqsec3 T A 6: 121,386,610 H895L possibly damaging Het
Itgb7 A G 15: 102,219,254 S410P probably damaging Het
Kmt2d C A 15: 98,856,384 V1613F unknown Het
Lama1 T C 17: 67,717,261 L118P Het
Lrrc25 A T 8: 70,618,180 S204C possibly damaging Het
Malrd1 A G 2: 15,695,199 D619G unknown Het
Ms4a6d G A 19: 11,590,073 Q155* probably null Het
Mup17 G A 4: 61,594,398 S86F probably benign Het
Nbeal2 C T 9: 110,630,189 probably null Het
Nfkb1 A C 3: 135,613,697 V291G possibly damaging Het
Nomo1 G T 7: 46,066,479 V757F probably benign Het
Nutm2 T A 13: 50,470,007 S247T probably damaging Het
Olfr1225 C T 2: 89,170,361 V284I probably benign Het
Olfr1291-ps1 G T 2: 111,499,896 A215S probably damaging Het
Olfr521 C A 7: 99,767,346 H61Q probably damaging Het
Olfr826 T A 10: 130,180,254 I209F probably damaging Het
Olfr834 T A 9: 18,988,710 C241S probably damaging Het
Pcdhb14 A G 18: 37,448,908 I356V probably benign Het
Pnkp T A 7: 44,858,678 S142T probably damaging Het
Ppia T C 11: 6,419,218 S99P possibly damaging Het
Prss47 C T 13: 65,044,993 V325I probably benign Het
Ptk7 T C 17: 46,591,757 D34G probably damaging Het
Pwp2 C T 10: 78,182,480 G126R probably damaging Het
Rasa3 G T 8: 13,595,353 D195E probably benign Het
Rnf150 T A 8: 82,990,471 Y202* probably null Het
Sh2d1b2 T C 1: 170,248,147 V50A probably damaging Het
Slc30a4 C T 2: 122,685,304 V390I possibly damaging Het
Slc30a9 G T 5: 67,352,766 probably null Het
Slc8a3 T A 12: 81,214,058 probably null Het
Smpd3 G A 8: 106,265,010 R304W probably damaging Het
Snta1 A G 2: 154,376,860 S490P probably damaging Het
Srcap T G 7: 127,534,828 M887R probably damaging Het
St3gal1 A G 15: 67,111,346 V187A possibly damaging Het
Sult2a3 T C 7: 14,111,524 T137A probably benign Het
Tspoap1 C T 11: 87,766,119 Q367* probably null Het
Ush2a T C 1: 188,911,416 I4325T possibly damaging Het
Vmn1r32 A G 6: 66,553,189 I201T probably benign Het
Zadh2 C T 18: 84,088,190 A9V probably benign Het
Zfp651 T A 9: 121,767,345 M626K probably damaging Het
Other mutations in Uroc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00963:Uroc1 APN 6 90338828 missense probably benign
IGL01015:Uroc1 APN 6 90358901 splice site probably benign
IGL01386:Uroc1 APN 6 90346765 missense probably damaging 0.99
IGL01449:Uroc1 APN 6 90338653 missense probably damaging 1.00
IGL01514:Uroc1 APN 6 90363100 splice site probably benign
IGL02060:Uroc1 APN 6 90338255 missense probably benign 0.03
IGL02247:Uroc1 APN 6 90347928 missense probably benign 0.00
IGL02256:Uroc1 APN 6 90346687 missense possibly damaging 0.83
IGL02886:Uroc1 APN 6 90346829 splice site probably benign
IGL03087:Uroc1 APN 6 90363103 splice site probably benign
PIT4651001:Uroc1 UTSW 6 90363113 nonsense probably null
R0034:Uroc1 UTSW 6 90345310 missense probably damaging 1.00
R0245:Uroc1 UTSW 6 90344197 missense probably damaging 1.00
R0402:Uroc1 UTSW 6 90347302 missense probably damaging 1.00
R0570:Uroc1 UTSW 6 90338564 missense possibly damaging 0.90
R0729:Uroc1 UTSW 6 90336955 missense probably damaging 1.00
R1471:Uroc1 UTSW 6 90344171 missense probably damaging 1.00
R1782:Uroc1 UTSW 6 90336919 missense probably damaging 1.00
R1866:Uroc1 UTSW 6 90361524 missense probably benign 0.03
R1983:Uroc1 UTSW 6 90345369 missense probably damaging 1.00
R2086:Uroc1 UTSW 6 90344114 missense probably damaging 1.00
R2321:Uroc1 UTSW 6 90347247 missense possibly damaging 0.94
R3720:Uroc1 UTSW 6 90346355 missense probably damaging 1.00
R3874:Uroc1 UTSW 6 90361512 nonsense probably null
R4628:Uroc1 UTSW 6 90355328 missense probably damaging 0.99
R4810:Uroc1 UTSW 6 90363153 missense probably damaging 1.00
R4820:Uroc1 UTSW 6 90357618 critical splice donor site probably null
R4838:Uroc1 UTSW 6 90349192 missense possibly damaging 0.90
R4880:Uroc1 UTSW 6 90357537 missense probably damaging 1.00
R4964:Uroc1 UTSW 6 90345394 missense probably damaging 0.98
R4966:Uroc1 UTSW 6 90345394 missense probably damaging 0.98
R5468:Uroc1 UTSW 6 90338604 missense probably benign 0.45
R5592:Uroc1 UTSW 6 90355344 missense probably damaging 0.99
R5698:Uroc1 UTSW 6 90347320 missense probably damaging 1.00
R5789:Uroc1 UTSW 6 90344197 missense probably damaging 1.00
R5853:Uroc1 UTSW 6 90346756 missense probably damaging 0.99
R6063:Uroc1 UTSW 6 90347928 missense probably benign 0.37
R6883:Uroc1 UTSW 6 90338592 nonsense probably null
R7374:Uroc1 UTSW 6 90338833 missense probably damaging 1.00
R7427:Uroc1 UTSW 6 90346362 missense possibly damaging 0.56
R8376:Uroc1 UTSW 6 90337715 missense probably damaging 0.99
X0021:Uroc1 UTSW 6 90344150 missense probably benign 0.40
Predicted Primers PCR Primer
(F):5'- GGGAAGAGACACATCAGCTC -3'
(R):5'- GAGCGGAACCTCTGGATCATAC -3'

Sequencing Primer
(F):5'- GCTCTGTATCTCAGCAGGGAAAC -3'
(R):5'- GGAACCTCTGGATCATACCTGTG -3'
Posted On2019-09-13