Incidental Mutation 'R7394:Uroc1'
ID 573654
Institutional Source Beutler Lab
Gene Symbol Uroc1
Ensembl Gene ENSMUSG00000034456
Gene Name urocanase domain containing 1
Synonyms
MMRRC Submission 045476-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R7394 (G1)
Quality Score 225.009
Status Validated
Chromosome 6
Chromosomal Location 90310266-90341533 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 90322315 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Arginine to Cysteine at position 280 (R280C)
Ref Sequence ENSEMBL: ENSMUSP00000127114 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046128] [ENSMUST00000164761]
AlphaFold Q8VC12
Predicted Effect probably damaging
Transcript: ENSMUST00000046128
AA Change: R280C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000040424
Gene: ENSMUSG00000034456
AA Change: R280C

DomainStartEndE-ValueType
Pfam:Urocanase 84 662 2.7e-231 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000164761
AA Change: R280C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000127114
Gene: ENSMUSG00000034456
AA Change: R280C

DomainStartEndE-ValueType
Pfam:Urocanase 85 316 1.4e-102 PFAM
Pfam:Urocanase 319 683 8.7e-144 PFAM
Meta Mutation Damage Score 0.5135 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 99% (66/67)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an enzyme involved in histidine catabolism, metabolizing urocanic acid to formiminoglutamic acid. The gene product is known to protect the skin from ultra violet rays and is contained in human sweat. Deficiency of this gene product in the liver is an apparent cause of mental retardation. Multiple transcript variants encoding different isoforms have been found for this gene.[provided by RefSeq, Sep 2009]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700017N19Rik A G 10: 100,445,038 (GRCm39) I208V probably benign Het
Abcb11 C T 2: 69,130,211 (GRCm39) D282N probably damaging Het
Aldh1l2 T A 10: 83,338,321 (GRCm39) I646F probably damaging Het
Alms1 C T 6: 85,599,205 (GRCm39) P1344S possibly damaging Het
Ank2 T A 3: 126,730,302 (GRCm39) I711L possibly damaging Het
Ankrd6 T C 4: 32,821,298 (GRCm39) N251D probably damaging Het
Ap3m1 T C 14: 21,088,147 (GRCm39) T304A probably benign Het
Arhgef39 T C 4: 43,499,532 (GRCm39) T26A possibly damaging Het
Carnmt1 G T 19: 18,648,201 (GRCm39) probably benign Het
Ccr4 C T 9: 114,320,994 (GRCm39) R357H probably benign Het
Cd4 T A 6: 124,850,004 (GRCm39) M104L probably benign Het
Cd74 A T 18: 60,936,965 (GRCm39) probably benign Het
Cdcp1 T C 9: 123,002,878 (GRCm39) Y731C probably damaging Het
Cdyl2 A G 8: 117,350,790 (GRCm39) S114P not run Het
Cenpv T C 11: 62,427,114 (GRCm39) D148G probably damaging Het
Cep89 G A 7: 35,129,353 (GRCm39) R630H probably damaging Het
Cfap57 T A 4: 118,450,334 (GRCm39) Y596F probably benign Het
Clec4a2 C A 6: 123,116,079 (GRCm39) A122E unknown Het
Col4a2 A G 8: 11,496,184 (GRCm39) T1602A probably benign Het
Cracd GCGCGAGGCCGAGAGGCAGGAGGAGGAAGCAAGACAACGCGAGGCCGAGAGGCAGG GCGCGAGGCCGAGAGGCAGG 5: 77,004,801 (GRCm39) probably benign Het
Cyp2j11 A T 4: 96,204,677 (GRCm39) Y290N probably benign Het
Dhx38 A T 8: 110,283,155 (GRCm39) V554E probably damaging Het
Ebf2 T C 14: 67,474,975 (GRCm39) V70A probably damaging Het
Enpp5 G A 17: 44,396,155 (GRCm39) G356S probably damaging Het
Fam217a A T 13: 35,094,262 (GRCm39) I499K possibly damaging Het
Fras1 C A 5: 96,860,309 (GRCm39) Y2118* probably null Het
Gm3248 A T 14: 5,945,781 (GRCm38) probably null Het
Gm5460 T G 14: 33,765,879 (GRCm39) D165E possibly damaging Het
Grk4 A T 5: 34,908,962 (GRCm39) N490Y probably benign Het
Iglc2 T A 16: 19,013,886 (GRCm39) K59* probably null Het
Iqsec3 T A 6: 121,363,569 (GRCm39) H895L possibly damaging Het
Itgb7 A G 15: 102,127,689 (GRCm39) S410P probably damaging Het
Kmt2d C A 15: 98,754,265 (GRCm39) V1613F unknown Het
Lama1 T C 17: 68,024,256 (GRCm39) L118P Het
Lrrc25 A T 8: 71,070,830 (GRCm39) S204C possibly damaging Het
Malrd1 A G 2: 15,700,010 (GRCm39) D619G unknown Het
Ms4a6d G A 19: 11,567,437 (GRCm39) Q155* probably null Het
Mup17 G A 4: 61,512,635 (GRCm39) S86F probably benign Het
Nbeal2 C T 9: 110,459,257 (GRCm39) probably null Het
Nfkb1 A C 3: 135,319,458 (GRCm39) V291G possibly damaging Het
Nomo1 G T 7: 45,715,903 (GRCm39) V757F probably benign Het
Nutm2 T A 13: 50,624,043 (GRCm39) S247T probably damaging Het
Or2at1 C A 7: 99,416,553 (GRCm39) H61Q probably damaging Het
Or4c120 C T 2: 89,000,705 (GRCm39) V284I probably benign Het
Or4f4-ps1 G T 2: 111,330,241 (GRCm39) A215S probably damaging Het
Or7g12 T A 9: 18,900,006 (GRCm39) C241S probably damaging Het
Or9k2b T A 10: 130,016,123 (GRCm39) I209F probably damaging Het
Pcdhb14 A G 18: 37,581,961 (GRCm39) I356V probably benign Het
Pnkp T A 7: 44,508,102 (GRCm39) S142T probably damaging Het
Ppia T C 11: 6,369,218 (GRCm39) S99P possibly damaging Het
Prss47 C T 13: 65,192,807 (GRCm39) V325I probably benign Het
Ptgr3 C T 18: 84,106,315 (GRCm39) A9V probably benign Het
Ptk7 T C 17: 46,902,683 (GRCm39) D34G probably damaging Het
Pwp2 C T 10: 78,018,314 (GRCm39) G126R probably damaging Het
Rasa3 G T 8: 13,645,353 (GRCm39) D195E probably benign Het
Rnf150 T A 8: 83,717,100 (GRCm39) Y202* probably null Het
Sh2d1b2 T C 1: 170,075,716 (GRCm39) V50A probably damaging Het
Slc30a4 C T 2: 122,527,224 (GRCm39) V390I possibly damaging Het
Slc30a9 G T 5: 67,510,109 (GRCm39) probably null Het
Slc8a3 T A 12: 81,260,832 (GRCm39) probably null Het
Smpd3 G A 8: 106,991,642 (GRCm39) R304W probably damaging Het
Snta1 A G 2: 154,218,780 (GRCm39) S490P probably damaging Het
Srcap T G 7: 127,134,000 (GRCm39) M887R probably damaging Het
St3gal1 A G 15: 66,983,195 (GRCm39) V187A possibly damaging Het
Sult2a3 T C 7: 13,845,449 (GRCm39) T137A probably benign Het
Tspoap1 C T 11: 87,656,945 (GRCm39) Q367* probably null Het
Ush2a T C 1: 188,643,613 (GRCm39) I4325T possibly damaging Het
Vmn1r32 A G 6: 66,530,173 (GRCm39) I201T probably benign Het
Zbtb47 T A 9: 121,596,411 (GRCm39) M626K probably damaging Het
Other mutations in Uroc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00963:Uroc1 APN 6 90,315,810 (GRCm39) missense probably benign
IGL01015:Uroc1 APN 6 90,335,883 (GRCm39) splice site probably benign
IGL01386:Uroc1 APN 6 90,323,747 (GRCm39) missense probably damaging 0.99
IGL01449:Uroc1 APN 6 90,315,635 (GRCm39) missense probably damaging 1.00
IGL01514:Uroc1 APN 6 90,340,082 (GRCm39) splice site probably benign
IGL02060:Uroc1 APN 6 90,315,237 (GRCm39) missense probably benign 0.03
IGL02247:Uroc1 APN 6 90,324,910 (GRCm39) missense probably benign 0.00
IGL02256:Uroc1 APN 6 90,323,669 (GRCm39) missense possibly damaging 0.83
IGL02886:Uroc1 APN 6 90,323,811 (GRCm39) splice site probably benign
IGL03087:Uroc1 APN 6 90,340,085 (GRCm39) splice site probably benign
PIT4651001:Uroc1 UTSW 6 90,340,095 (GRCm39) nonsense probably null
R0034:Uroc1 UTSW 6 90,322,292 (GRCm39) missense probably damaging 1.00
R0245:Uroc1 UTSW 6 90,321,179 (GRCm39) missense probably damaging 1.00
R0402:Uroc1 UTSW 6 90,324,284 (GRCm39) missense probably damaging 1.00
R0570:Uroc1 UTSW 6 90,315,546 (GRCm39) missense possibly damaging 0.90
R0729:Uroc1 UTSW 6 90,313,937 (GRCm39) missense probably damaging 1.00
R1471:Uroc1 UTSW 6 90,321,153 (GRCm39) missense probably damaging 1.00
R1782:Uroc1 UTSW 6 90,313,901 (GRCm39) missense probably damaging 1.00
R1866:Uroc1 UTSW 6 90,338,506 (GRCm39) missense probably benign 0.03
R1983:Uroc1 UTSW 6 90,322,351 (GRCm39) missense probably damaging 1.00
R2086:Uroc1 UTSW 6 90,321,096 (GRCm39) missense probably damaging 1.00
R2321:Uroc1 UTSW 6 90,324,229 (GRCm39) missense possibly damaging 0.94
R3720:Uroc1 UTSW 6 90,323,337 (GRCm39) missense probably damaging 1.00
R3874:Uroc1 UTSW 6 90,338,494 (GRCm39) nonsense probably null
R4628:Uroc1 UTSW 6 90,332,310 (GRCm39) missense probably damaging 0.99
R4810:Uroc1 UTSW 6 90,340,135 (GRCm39) missense probably damaging 1.00
R4820:Uroc1 UTSW 6 90,334,600 (GRCm39) critical splice donor site probably null
R4838:Uroc1 UTSW 6 90,326,174 (GRCm39) missense possibly damaging 0.90
R4880:Uroc1 UTSW 6 90,334,519 (GRCm39) missense probably damaging 1.00
R4964:Uroc1 UTSW 6 90,322,376 (GRCm39) missense probably damaging 0.98
R4966:Uroc1 UTSW 6 90,322,376 (GRCm39) missense probably damaging 0.98
R5468:Uroc1 UTSW 6 90,315,586 (GRCm39) missense probably benign 0.45
R5592:Uroc1 UTSW 6 90,332,326 (GRCm39) missense probably damaging 0.99
R5698:Uroc1 UTSW 6 90,324,302 (GRCm39) missense probably damaging 1.00
R5789:Uroc1 UTSW 6 90,321,179 (GRCm39) missense probably damaging 1.00
R5853:Uroc1 UTSW 6 90,323,738 (GRCm39) missense probably damaging 0.99
R6063:Uroc1 UTSW 6 90,324,910 (GRCm39) missense probably benign 0.37
R6883:Uroc1 UTSW 6 90,315,574 (GRCm39) nonsense probably null
R7374:Uroc1 UTSW 6 90,315,815 (GRCm39) missense probably damaging 1.00
R7427:Uroc1 UTSW 6 90,323,344 (GRCm39) missense possibly damaging 0.56
R8224:Uroc1 UTSW 6 90,321,049 (GRCm39) splice site probably null
R8376:Uroc1 UTSW 6 90,314,697 (GRCm39) missense probably damaging 0.99
R8807:Uroc1 UTSW 6 90,328,110 (GRCm39) missense probably damaging 1.00
R8857:Uroc1 UTSW 6 90,334,510 (GRCm39) missense possibly damaging 0.74
R9418:Uroc1 UTSW 6 90,313,880 (GRCm39) missense probably benign 0.00
R9440:Uroc1 UTSW 6 90,322,353 (GRCm39) missense possibly damaging 0.94
X0021:Uroc1 UTSW 6 90,321,132 (GRCm39) missense probably benign 0.40
Predicted Primers PCR Primer
(F):5'- GGGAAGAGACACATCAGCTC -3'
(R):5'- GAGCGGAACCTCTGGATCATAC -3'

Sequencing Primer
(F):5'- GCTCTGTATCTCAGCAGGGAAAC -3'
(R):5'- GGAACCTCTGGATCATACCTGTG -3'
Posted On 2019-09-13