Incidental Mutation 'R7394:Olfr521'
ID573661
Institutional Source Beutler Lab
Gene Symbol Olfr521
Ensembl Gene ENSMUSG00000073997
Gene Nameolfactory receptor 521
SynonymsMOR101-2, GA_x6K02T2PBJ9-2443810-2444775
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.099) question?
Stock #R7394 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location99763507-99769321 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 99767346 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Glutamine at position 61 (H61Q)
Ref Sequence ENSEMBL: ENSMUSP00000151473 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000098263] [ENSMUST00000219663] [ENSMUST00000220001]
Predicted Effect probably damaging
Transcript: ENSMUST00000098263
AA Change: H61Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000095863
Gene: ENSMUSG00000073997
AA Change: H61Q

DomainStartEndE-ValueType
Pfam:7tm_4 36 313 1.4e-63 PFAM
Pfam:7TM_GPCR_Srsx 40 310 7.4e-6 PFAM
Pfam:7tm_1 46 309 2e-28 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000219663
AA Change: H61Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000220001
AA Change: H61Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 99% (66/67)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700017N19Rik A G 10: 100,609,176 I208V probably benign Het
Abcb11 C T 2: 69,299,867 D282N probably damaging Het
Aldh1l2 T A 10: 83,502,457 I646F probably damaging Het
Alms1 C T 6: 85,622,223 P1344S possibly damaging Het
Ank2 T A 3: 126,936,653 I711L possibly damaging Het
Ankrd6 T C 4: 32,821,298 N251D probably damaging Het
Ap3m1 T C 14: 21,038,079 T304A probably benign Het
Arhgef39 T C 4: 43,499,532 T26A possibly damaging Het
C530008M17Rik GCGCGAGGCCGAGAGGCAGGAGGAGGAAGCAAGACAACGCGAGGCCGAGAGGCAGG GCGCGAGGCCGAGAGGCAGG 5: 76,856,954 probably benign Het
Carnmt1 G T 19: 18,670,837 probably benign Het
Ccr4 C T 9: 114,491,926 R357H probably benign Het
Cd4 T A 6: 124,873,041 M104L probably benign Het
Cd74 A T 18: 60,803,893 probably benign Het
Cdcp1 T C 9: 123,173,813 Y731C probably damaging Het
Cdyl2 A G 8: 116,624,051 S114P not run Het
Cenpv T C 11: 62,536,288 D148G probably damaging Het
Cep89 G A 7: 35,429,928 R630H probably damaging Het
Cfap57 T A 4: 118,593,137 Y596F probably benign Het
Clec4a2 C A 6: 123,139,120 A122E unknown Het
Col4a2 A G 8: 11,446,184 T1602A probably benign Het
Cyp2j11 A T 4: 96,316,440 Y290N probably benign Het
Dhx38 A T 8: 109,556,523 V554E probably damaging Het
Ebf2 T C 14: 67,237,526 V70A probably damaging Het
Enpp5 G A 17: 44,085,264 G356S probably damaging Het
Fam217a A T 13: 34,910,279 I499K possibly damaging Het
Fras1 C A 5: 96,712,450 Y2118* probably null Het
Gm3248 A T 14: 5,945,781 probably null Het
Gm5460 T G 14: 34,043,922 D165E possibly damaging Het
Grk4 A T 5: 34,751,618 N490Y probably benign Het
Iglc2 T A 16: 19,195,136 K59* probably null Het
Iqsec3 T A 6: 121,386,610 H895L possibly damaging Het
Itgb7 A G 15: 102,219,254 S410P probably damaging Het
Kmt2d C A 15: 98,856,384 V1613F unknown Het
Lama1 T C 17: 67,717,261 L118P Het
Lrrc25 A T 8: 70,618,180 S204C possibly damaging Het
Malrd1 A G 2: 15,695,199 D619G unknown Het
Ms4a6d G A 19: 11,590,073 Q155* probably null Het
Mup17 G A 4: 61,594,398 S86F probably benign Het
Nbeal2 C T 9: 110,630,189 probably null Het
Nfkb1 A C 3: 135,613,697 V291G possibly damaging Het
Nomo1 G T 7: 46,066,479 V757F probably benign Het
Nutm2 T A 13: 50,470,007 S247T probably damaging Het
Olfr1225 C T 2: 89,170,361 V284I probably benign Het
Olfr1291-ps1 G T 2: 111,499,896 A215S probably damaging Het
Olfr826 T A 10: 130,180,254 I209F probably damaging Het
Olfr834 T A 9: 18,988,710 C241S probably damaging Het
Pcdhb14 A G 18: 37,448,908 I356V probably benign Het
Pnkp T A 7: 44,858,678 S142T probably damaging Het
Ppia T C 11: 6,419,218 S99P possibly damaging Het
Prss47 C T 13: 65,044,993 V325I probably benign Het
Ptk7 T C 17: 46,591,757 D34G probably damaging Het
Pwp2 C T 10: 78,182,480 G126R probably damaging Het
Rasa3 G T 8: 13,595,353 D195E probably benign Het
Rnf150 T A 8: 82,990,471 Y202* probably null Het
Sh2d1b2 T C 1: 170,248,147 V50A probably damaging Het
Slc30a4 C T 2: 122,685,304 V390I possibly damaging Het
Slc30a9 G T 5: 67,352,766 probably null Het
Slc8a3 T A 12: 81,214,058 probably null Het
Smpd3 G A 8: 106,265,010 R304W probably damaging Het
Snta1 A G 2: 154,376,860 S490P probably damaging Het
Srcap T G 7: 127,534,828 M887R probably damaging Het
St3gal1 A G 15: 67,111,346 V187A possibly damaging Het
Sult2a3 T C 7: 14,111,524 T137A probably benign Het
Tspoap1 C T 11: 87,766,119 Q367* probably null Het
Uroc1 C T 6: 90,345,333 R280C probably damaging Het
Ush2a T C 1: 188,911,416 I4325T possibly damaging Het
Vmn1r32 A G 6: 66,553,189 I201T probably benign Het
Zadh2 C T 18: 84,088,190 A9V probably benign Het
Zfp651 T A 9: 121,767,345 M626K probably damaging Het
Other mutations in Olfr521
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02303:Olfr521 APN 7 99767972 missense possibly damaging 0.73
IGL02491:Olfr521 APN 7 99767333 missense possibly damaging 0.85
BB007:Olfr521 UTSW 7 99767596 missense probably benign 0.37
BB017:Olfr521 UTSW 7 99767596 missense probably benign 0.37
R0544:Olfr521 UTSW 7 99767660 missense probably benign
R1029:Olfr521 UTSW 7 99767224 missense probably benign 0.01
R1840:Olfr521 UTSW 7 99767596 missense probably benign 0.37
R4709:Olfr521 UTSW 7 99767782 missense probably damaging 1.00
R5215:Olfr521 UTSW 7 99767510 missense probably damaging 1.00
R5752:Olfr521 UTSW 7 99767948 missense probably benign 0.00
R5934:Olfr521 UTSW 7 99767389 missense probably damaging 1.00
R6913:Olfr521 UTSW 7 99767717 missense probably damaging 1.00
R7554:Olfr521 UTSW 7 99768003 missense possibly damaging 0.62
R7930:Olfr521 UTSW 7 99767596 missense probably benign 0.37
Z1177:Olfr521 UTSW 7 99767914 missense possibly damaging 0.92
Predicted Primers PCR Primer
(F):5'- GTAGAAACCTCCTGAGCATCGG -3'
(R):5'- ATGACCACCAGGATGAAGGC -3'

Sequencing Primer
(F):5'- CCATGGAAAACATAGCCTGTAATG -3'
(R):5'- ACCACCAGGATGAAGGCTTCTG -3'
Posted On2019-09-13