Incidental Mutation 'R7394:Dhx38'
ID573668
Institutional Source Beutler Lab
Gene Symbol Dhx38
Ensembl Gene ENSMUSG00000037993
Gene NameDEAH (Asp-Glu-Ala-His) box polypeptide 38
Synonyms5730550P09Rik, Ddx38, Prp16
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.955) question?
Stock #R7394 (G1)
Quality Score225.009
Status Validated
Chromosome8
Chromosomal Location109548011-109565861 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 109556523 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glutamic Acid at position 554 (V554E)
Ref Sequence ENSEMBL: ENSMUSP00000047865 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042601]
Predicted Effect probably damaging
Transcript: ENSMUST00000042601
AA Change: V554E

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000047865
Gene: ENSMUSG00000037993
AA Change: V554E

DomainStartEndE-ValueType
Blast:DEXDc 3 146 2e-46 BLAST
low complexity region 147 204 N/A INTRINSIC
Blast:DEXDc 205 444 1e-105 BLAST
low complexity region 511 525 N/A INTRINSIC
DEXDc 531 715 6.88e-34 SMART
HELICc 759 862 1.11e-19 SMART
HA2 923 1013 3.22e-32 SMART
low complexity region 1163 1194 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 99% (66/67)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] DEAD box proteins, characterized by the conserved motif Asp-Glu-Ala-Asp (DEAD), are putative RNA helicases. They are implicated in a number of cellular processes involving alteration of RNA secondary structure such as translation initiation, nuclear and mitochondrial splicing, and ribosome and spliceosome assembly. Based on their distribution patterns, some members of this family are believed to be involved in embryogenesis, spermatogenesis, and cellular growth and division. The protein encoded by this gene is a member of the DEAD/H box family of splicing factors. This protein resembles yeast Prp16 more closely than other DEAD/H family members. It is an ATPase and essential for the catalytic step II in pre-mRNA splicing process. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700017N19Rik A G 10: 100,609,176 I208V probably benign Het
Abcb11 C T 2: 69,299,867 D282N probably damaging Het
Aldh1l2 T A 10: 83,502,457 I646F probably damaging Het
Alms1 C T 6: 85,622,223 P1344S possibly damaging Het
Ank2 T A 3: 126,936,653 I711L possibly damaging Het
Ankrd6 T C 4: 32,821,298 N251D probably damaging Het
Ap3m1 T C 14: 21,038,079 T304A probably benign Het
Arhgef39 T C 4: 43,499,532 T26A possibly damaging Het
C530008M17Rik GCGCGAGGCCGAGAGGCAGGAGGAGGAAGCAAGACAACGCGAGGCCGAGAGGCAGG GCGCGAGGCCGAGAGGCAGG 5: 76,856,954 probably benign Het
Carnmt1 G T 19: 18,670,837 probably benign Het
Ccr4 C T 9: 114,491,926 R357H probably benign Het
Cd4 T A 6: 124,873,041 M104L probably benign Het
Cd74 A T 18: 60,803,893 probably benign Het
Cdcp1 T C 9: 123,173,813 Y731C probably damaging Het
Cdyl2 A G 8: 116,624,051 S114P not run Het
Cenpv T C 11: 62,536,288 D148G probably damaging Het
Cep89 G A 7: 35,429,928 R630H probably damaging Het
Cfap57 T A 4: 118,593,137 Y596F probably benign Het
Clec4a2 C A 6: 123,139,120 A122E unknown Het
Col4a2 A G 8: 11,446,184 T1602A probably benign Het
Cyp2j11 A T 4: 96,316,440 Y290N probably benign Het
Ebf2 T C 14: 67,237,526 V70A probably damaging Het
Enpp5 G A 17: 44,085,264 G356S probably damaging Het
Fam217a A T 13: 34,910,279 I499K possibly damaging Het
Fras1 C A 5: 96,712,450 Y2118* probably null Het
Gm3248 A T 14: 5,945,781 probably null Het
Gm5460 T G 14: 34,043,922 D165E possibly damaging Het
Grk4 A T 5: 34,751,618 N490Y probably benign Het
Iglc2 T A 16: 19,195,136 K59* probably null Het
Iqsec3 T A 6: 121,386,610 H895L possibly damaging Het
Itgb7 A G 15: 102,219,254 S410P probably damaging Het
Kmt2d C A 15: 98,856,384 V1613F unknown Het
Lama1 T C 17: 67,717,261 L118P Het
Lrrc25 A T 8: 70,618,180 S204C possibly damaging Het
Malrd1 A G 2: 15,695,199 D619G unknown Het
Ms4a6d G A 19: 11,590,073 Q155* probably null Het
Mup17 G A 4: 61,594,398 S86F probably benign Het
Nbeal2 C T 9: 110,630,189 probably null Het
Nfkb1 A C 3: 135,613,697 V291G possibly damaging Het
Nomo1 G T 7: 46,066,479 V757F probably benign Het
Nutm2 T A 13: 50,470,007 S247T probably damaging Het
Olfr1225 C T 2: 89,170,361 V284I probably benign Het
Olfr1291-ps1 G T 2: 111,499,896 A215S probably damaging Het
Olfr521 C A 7: 99,767,346 H61Q probably damaging Het
Olfr826 T A 10: 130,180,254 I209F probably damaging Het
Olfr834 T A 9: 18,988,710 C241S probably damaging Het
Pcdhb14 A G 18: 37,448,908 I356V probably benign Het
Pnkp T A 7: 44,858,678 S142T probably damaging Het
Ppia T C 11: 6,419,218 S99P possibly damaging Het
Prss47 C T 13: 65,044,993 V325I probably benign Het
Ptk7 T C 17: 46,591,757 D34G probably damaging Het
Pwp2 C T 10: 78,182,480 G126R probably damaging Het
Rasa3 G T 8: 13,595,353 D195E probably benign Het
Rnf150 T A 8: 82,990,471 Y202* probably null Het
Sh2d1b2 T C 1: 170,248,147 V50A probably damaging Het
Slc30a4 C T 2: 122,685,304 V390I possibly damaging Het
Slc30a9 G T 5: 67,352,766 probably null Het
Slc8a3 T A 12: 81,214,058 probably null Het
Smpd3 G A 8: 106,265,010 R304W probably damaging Het
Snta1 A G 2: 154,376,860 S490P probably damaging Het
Srcap T G 7: 127,534,828 M887R probably damaging Het
St3gal1 A G 15: 67,111,346 V187A possibly damaging Het
Sult2a3 T C 7: 14,111,524 T137A probably benign Het
Tspoap1 C T 11: 87,766,119 Q367* probably null Het
Uroc1 C T 6: 90,345,333 R280C probably damaging Het
Ush2a T C 1: 188,911,416 I4325T possibly damaging Het
Vmn1r32 A G 6: 66,553,189 I201T probably benign Het
Zadh2 C T 18: 84,088,190 A9V probably benign Het
Zfp651 T A 9: 121,767,345 M626K probably damaging Het
Other mutations in Dhx38
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00508:Dhx38 APN 8 109556934 missense possibly damaging 0.49
IGL00821:Dhx38 APN 8 109555654 missense probably benign 0.00
IGL00910:Dhx38 APN 8 109559034 missense probably benign 0.07
IGL01011:Dhx38 APN 8 109562691 missense probably benign
IGL01401:Dhx38 APN 8 109552114 missense probably benign 0.15
IGL02133:Dhx38 APN 8 109558241 nonsense probably null
IGL02529:Dhx38 APN 8 109559013 missense probably benign 0.00
IGL02652:Dhx38 APN 8 109556129 missense probably damaging 1.00
IGL03241:Dhx38 APN 8 109562656 missense possibly damaging 0.47
IGL03378:Dhx38 APN 8 109559090 splice site probably null
R0358:Dhx38 UTSW 8 109552462 missense probably benign 0.13
R0375:Dhx38 UTSW 8 109555181 missense possibly damaging 0.89
R0437:Dhx38 UTSW 8 109558629 splice site probably benign
R0481:Dhx38 UTSW 8 109556216 splice site probably benign
R0492:Dhx38 UTSW 8 109561944 splice site probably benign
R0528:Dhx38 UTSW 8 109562661 missense probably benign 0.00
R0607:Dhx38 UTSW 8 109558943 missense probably benign 0.07
R1638:Dhx38 UTSW 8 109553545 missense probably damaging 1.00
R2020:Dhx38 UTSW 8 109556869 splice site probably benign
R2056:Dhx38 UTSW 8 109562720 unclassified probably benign
R2096:Dhx38 UTSW 8 109554259 missense probably damaging 1.00
R2152:Dhx38 UTSW 8 109560674 missense probably benign 0.00
R2154:Dhx38 UTSW 8 109560674 missense probably benign 0.00
R2382:Dhx38 UTSW 8 109556140 missense probably damaging 0.99
R4367:Dhx38 UTSW 8 109553131 missense probably damaging 1.00
R4368:Dhx38 UTSW 8 109553131 missense probably damaging 1.00
R4369:Dhx38 UTSW 8 109553131 missense probably damaging 1.00
R5250:Dhx38 UTSW 8 109556520 missense probably damaging 1.00
R5354:Dhx38 UTSW 8 109555746 missense probably damaging 1.00
R5668:Dhx38 UTSW 8 109553416 missense probably damaging 1.00
R5777:Dhx38 UTSW 8 109556902 missense possibly damaging 0.81
R5784:Dhx38 UTSW 8 109559613 nonsense probably null
R6799:Dhx38 UTSW 8 109553202 missense probably damaging 1.00
R6915:Dhx38 UTSW 8 109559599 missense probably benign 0.15
R6932:Dhx38 UTSW 8 109552675 missense probably damaging 1.00
R7042:Dhx38 UTSW 8 109556985 missense possibly damaging 0.55
R7248:Dhx38 UTSW 8 109558927 missense probably benign 0.15
R7513:Dhx38 UTSW 8 109560589 missense probably benign 0.00
R7569:Dhx38 UTSW 8 109560695 missense probably damaging 0.98
R8003:Dhx38 UTSW 8 109556140 missense probably damaging 0.99
R8071:Dhx38 UTSW 8 109558701 missense probably benign 0.10
R8537:Dhx38 UTSW 8 109553380 missense probably damaging 1.00
R8852:Dhx38 UTSW 8 109562729 nonsense probably null
R8860:Dhx38 UTSW 8 109562729 nonsense probably null
Z1177:Dhx38 UTSW 8 109556085 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CTTCCAGCACAAATGGCAGAAG -3'
(R):5'- CTGGTTTCTGGTGAACCCTC -3'

Sequencing Primer
(F):5'- GCTACATGGCTCAGACCTC -3'
(R):5'- TGAACCCTCTGGCCATGAATG -3'
Posted On2019-09-13