Incidental Mutation 'R7394:Olfr834'
ID573670
Institutional Source Beutler Lab
Gene Symbol Olfr834
Ensembl Gene ENSMUSG00000095525
Gene Nameolfactory receptor 834
SynonymsMOR153-2, GA_x6K02T2PVTD-12724921-12725859, MOR153-4_p
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.680) question?
Stock #R7394 (G1)
Quality Score225.009
Status Validated
Chromosome9
Chromosomal Location18987990-18988928 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 18988710 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Serine at position 241 (C241S)
Ref Sequence ENSEMBL: ENSMUSP00000083680 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000086492]
Predicted Effect probably damaging
Transcript: ENSMUST00000086492
AA Change: C241S

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000083680
Gene: ENSMUSG00000095525
AA Change: C241S

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 7.2e-51 PFAM
Pfam:7TM_GPCR_Srsx 35 305 7e-6 PFAM
Pfam:7tm_1 41 290 2.9e-20 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 99% (66/67)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700017N19Rik A G 10: 100,609,176 I208V probably benign Het
Abcb11 C T 2: 69,299,867 D282N probably damaging Het
Aldh1l2 T A 10: 83,502,457 I646F probably damaging Het
Alms1 C T 6: 85,622,223 P1344S possibly damaging Het
Ank2 T A 3: 126,936,653 I711L possibly damaging Het
Ankrd6 T C 4: 32,821,298 N251D probably damaging Het
Ap3m1 T C 14: 21,038,079 T304A probably benign Het
Arhgef39 T C 4: 43,499,532 T26A possibly damaging Het
C530008M17Rik GCGCGAGGCCGAGAGGCAGGAGGAGGAAGCAAGACAACGCGAGGCCGAGAGGCAGG GCGCGAGGCCGAGAGGCAGG 5: 76,856,954 probably benign Het
Carnmt1 G T 19: 18,670,837 probably benign Het
Ccr4 C T 9: 114,491,926 R357H probably benign Het
Cd4 T A 6: 124,873,041 M104L probably benign Het
Cd74 A T 18: 60,803,893 probably benign Het
Cdcp1 T C 9: 123,173,813 Y731C probably damaging Het
Cdyl2 A G 8: 116,624,051 S114P not run Het
Cenpv T C 11: 62,536,288 D148G probably damaging Het
Cep89 G A 7: 35,429,928 R630H probably damaging Het
Cfap57 T A 4: 118,593,137 Y596F probably benign Het
Clec4a2 C A 6: 123,139,120 A122E unknown Het
Col4a2 A G 8: 11,446,184 T1602A probably benign Het
Cyp2j11 A T 4: 96,316,440 Y290N probably benign Het
Dhx38 A T 8: 109,556,523 V554E probably damaging Het
Ebf2 T C 14: 67,237,526 V70A probably damaging Het
Enpp5 G A 17: 44,085,264 G356S probably damaging Het
Fam217a A T 13: 34,910,279 I499K possibly damaging Het
Fras1 C A 5: 96,712,450 Y2118* probably null Het
Gm3248 A T 14: 5,945,781 probably null Het
Gm5460 T G 14: 34,043,922 D165E possibly damaging Het
Grk4 A T 5: 34,751,618 N490Y probably benign Het
Iglc2 T A 16: 19,195,136 K59* probably null Het
Iqsec3 T A 6: 121,386,610 H895L possibly damaging Het
Itgb7 A G 15: 102,219,254 S410P probably damaging Het
Kmt2d C A 15: 98,856,384 V1613F unknown Het
Lama1 T C 17: 67,717,261 L118P Het
Lrrc25 A T 8: 70,618,180 S204C possibly damaging Het
Malrd1 A G 2: 15,695,199 D619G unknown Het
Ms4a6d G A 19: 11,590,073 Q155* probably null Het
Mup17 G A 4: 61,594,398 S86F probably benign Het
Nbeal2 C T 9: 110,630,189 probably null Het
Nfkb1 A C 3: 135,613,697 V291G possibly damaging Het
Nomo1 G T 7: 46,066,479 V757F probably benign Het
Nutm2 T A 13: 50,470,007 S247T probably damaging Het
Olfr1225 C T 2: 89,170,361 V284I probably benign Het
Olfr1291-ps1 G T 2: 111,499,896 A215S probably damaging Het
Olfr521 C A 7: 99,767,346 H61Q probably damaging Het
Olfr826 T A 10: 130,180,254 I209F probably damaging Het
Pcdhb14 A G 18: 37,448,908 I356V probably benign Het
Pnkp T A 7: 44,858,678 S142T probably damaging Het
Ppia T C 11: 6,419,218 S99P possibly damaging Het
Prss47 C T 13: 65,044,993 V325I probably benign Het
Ptk7 T C 17: 46,591,757 D34G probably damaging Het
Pwp2 C T 10: 78,182,480 G126R probably damaging Het
Rasa3 G T 8: 13,595,353 D195E probably benign Het
Rnf150 T A 8: 82,990,471 Y202* probably null Het
Sh2d1b2 T C 1: 170,248,147 V50A probably damaging Het
Slc30a4 C T 2: 122,685,304 V390I possibly damaging Het
Slc30a9 G T 5: 67,352,766 probably null Het
Slc8a3 T A 12: 81,214,058 probably null Het
Smpd3 G A 8: 106,265,010 R304W probably damaging Het
Snta1 A G 2: 154,376,860 S490P probably damaging Het
Srcap T G 7: 127,534,828 M887R probably damaging Het
St3gal1 A G 15: 67,111,346 V187A possibly damaging Het
Sult2a3 T C 7: 14,111,524 T137A probably benign Het
Tspoap1 C T 11: 87,766,119 Q367* probably null Het
Uroc1 C T 6: 90,345,333 R280C probably damaging Het
Ush2a T C 1: 188,911,416 I4325T possibly damaging Het
Vmn1r32 A G 6: 66,553,189 I201T probably benign Het
Zadh2 C T 18: 84,088,190 A9V probably benign Het
Zfp651 T A 9: 121,767,345 M626K probably damaging Het
Other mutations in Olfr834
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01804:Olfr834 APN 9 18988840 missense probably benign 0.16
IGL02073:Olfr834 APN 9 18988325 missense possibly damaging 0.89
IGL02119:Olfr834 APN 9 18988612 missense probably benign 0.00
IGL02705:Olfr834 APN 9 18988400 missense probably benign 0.03
R0462:Olfr834 UTSW 9 18988902 missense probably benign
R0466:Olfr834 UTSW 9 18988255 missense probably benign 0.00
R0709:Olfr834 UTSW 9 18988126 missense probably damaging 0.98
R0711:Olfr834 UTSW 9 18988151 missense probably benign 0.04
R1268:Olfr834 UTSW 9 18988356 missense probably damaging 0.98
R1663:Olfr834 UTSW 9 18988710 missense probably damaging 0.99
R1680:Olfr834 UTSW 9 18988516 missense possibly damaging 0.81
R1686:Olfr834 UTSW 9 18988543 missense probably damaging 1.00
R1903:Olfr834 UTSW 9 18988896 nonsense probably null
R1907:Olfr834 UTSW 9 18988441 missense possibly damaging 0.82
R1911:Olfr834 UTSW 9 18988900 missense probably damaging 0.99
R2143:Olfr834 UTSW 9 18988803 missense probably benign 0.06
R2431:Olfr834 UTSW 9 18988003 missense probably damaging 1.00
R4014:Olfr834 UTSW 9 18988882 missense probably benign 0.08
R4515:Olfr834 UTSW 9 18987982 splice site probably null
R4575:Olfr834 UTSW 9 18988705 nonsense probably null
R6974:Olfr834 UTSW 9 18988393 missense probably damaging 0.99
R7455:Olfr834 UTSW 9 18988854 missense possibly damaging 0.92
R7828:Olfr834 UTSW 9 18988920 missense probably benign
R7962:Olfr834 UTSW 9 18988656 missense probably damaging 0.97
R8360:Olfr834 UTSW 9 18988843 missense probably benign 0.28
R8812:Olfr834 UTSW 9 18988516 missense possibly damaging 0.81
Predicted Primers PCR Primer
(F):5'- GCACAAAGGTGGAAATTCCTC -3'
(R):5'- TTCTTGAAAGCACTGACCATGTC -3'

Sequencing Primer
(F):5'- GTGAACTGGCTCATATTCTCAAGC -3'
(R):5'- GAAAGCACTGACCATGTCTTTATTCC -3'
Posted On2019-09-13