Mutagenetix > Incidental Mutation

Incidental Mutation 'R7394:Tspoap1'

573681

Institutional Source

Beutler Lab

Gene Symbol

Tspoap1

Ensembl Gene

ENSMUSG00000034156

Gene Name

TSPO associated protein 1

Synonyms

Bzrap1, peripheral

MMRRC Submission

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R7394 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

87760541-87785928 bp(+) (GRCm38)

Type of Mutation

nonsense

DNA Base Change (assembly)

C to T at 87766119 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glutamine to Stop codon at position 367 (Q367*)

Ref Sequence

ENSEMBL: ENSMUSP00000048063 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000039627] [ENSMUST00000100644]

AlphaFold

Q7TNF8

Predicted Effect

probably null
Transcript: ENSMUST00000039627
AA Change: Q367*

SMART Domains

Protein: ENSMUSP00000048063
Gene: ENSMUSG00000034156
AA Change: Q367*

Domain	Start	End	E-Value	Type
coiled coil region	121	190	N/A	INTRINSIC
coiled coil region	219	249	N/A	INTRINSIC
low complexity region	301	309	N/A	INTRINSIC
coiled coil region	331	519	N/A	INTRINSIC
low complexity region	598	612	N/A	INTRINSIC
low complexity region	625	638	N/A	INTRINSIC
SH3	652	715	1.85e-11	SMART
low complexity region	733	759	N/A	INTRINSIC
FN3	784	864	3.14e0	SMART
FN3	878	951	4.81e-4	SMART
FN3	975	1062	7.16e0	SMART
low complexity region	1254	1265	N/A	INTRINSIC
low complexity region	1301	1313	N/A	INTRINSIC
low complexity region	1387	1401	N/A	INTRINSIC
low complexity region	1455	1471	N/A	INTRINSIC
SH3	1619	1683	5.4e-13	SMART
low complexity region	1721	1732	N/A	INTRINSIC
SH3	1758	1821	5.48e-14	SMART

Predicted Effect

probably null
Transcript: ENSMUST00000100644
AA Change: Q307*

SMART Domains

Protein: ENSMUSP00000098209
Gene: ENSMUSG00000034156
AA Change: Q307*

Domain	Start	End	E-Value	Type
coiled coil region	121	190	N/A	INTRINSIC
low complexity region	241	249	N/A	INTRINSIC
coiled coil region	271	459	N/A	INTRINSIC
low complexity region	538	552	N/A	INTRINSIC
low complexity region	565	578	N/A	INTRINSIC
SH3	592	655	1.85e-11	SMART
low complexity region	673	699	N/A	INTRINSIC
FN3	724	804	3.14e0	SMART
FN3	818	891	4.81e-4	SMART
FN3	915	1002	7.16e0	SMART
low complexity region	1194	1205	N/A	INTRINSIC
low complexity region	1241	1253	N/A	INTRINSIC
low complexity region	1327	1341	N/A	INTRINSIC
low complexity region	1395	1411	N/A	INTRINSIC
SH3	1559	1623	5.4e-13	SMART
low complexity region	1661	1672	N/A	INTRINSIC
SH3	1698	1761	5.48e-14	SMART

Meta Mutation Damage Score

0.9756

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 99.0%

Validation Efficiency

99% (66/67)

MGI Phenotype

PHENOTYPE: Homozygous double-KO with Rimbp2^tm1.2Geno does not exacerbate the phenotype of the latter single KO. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 69 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700017N19Rik	A	G	10: 100,609,176	I208V	probably benign	Het
Abcb11	C	T	2: 69,299,867	D282N	probably damaging	Het
Aldh1l2	T	A	10: 83,502,457	I646F	probably damaging	Het
Alms1	C	T	6: 85,622,223	P1344S	possibly damaging	Het
Ank2	T	A	3: 126,936,653	I711L	possibly damaging	Het
Ankrd6	T	C	4: 32,821,298	N251D	probably damaging	Het
Ap3m1	T	C	14: 21,038,079	T304A	probably benign	Het
Arhgef39	T	C	4: 43,499,532	T26A	possibly damaging	Het
C530008M17Rik	GCGCGAGGCCGAGAGGCAGGAGGAGGAAGCAAGACAACGCGAGGCCGAGAGGCAGG	GCGCGAGGCCGAGAGGCAGG	5: 76,856,954		probably benign	Het
Carnmt1	G	T	19: 18,670,837		probably benign	Het
Ccr4	C	T	9: 114,491,926	R357H	probably benign	Het
Cd4	T	A	6: 124,873,041	M104L	probably benign	Het
Cd74	A	T	18: 60,803,893		probably benign	Het
Cdcp1	T	C	9: 123,173,813	Y731C	probably damaging	Het
Cdyl2	A	G	8: 116,624,051	S114P	not run	Het
Cenpv	T	C	11: 62,536,288	D148G	probably damaging	Het
Cep89	G	A	7: 35,429,928	R630H	probably damaging	Het
Cfap57	T	A	4: 118,593,137	Y596F	probably benign	Het
Clec4a2	C	A	6: 123,139,120	A122E	unknown	Het
Col4a2	A	G	8: 11,446,184	T1602A	probably benign	Het
Cyp2j11	A	T	4: 96,316,440	Y290N	probably benign	Het
Dhx38	A	T	8: 109,556,523	V554E	probably damaging	Het
Ebf2	T	C	14: 67,237,526	V70A	probably damaging	Het
Enpp5	G	A	17: 44,085,264	G356S	probably damaging	Het
Fam217a	A	T	13: 34,910,279	I499K	possibly damaging	Het
Fras1	C	A	5: 96,712,450	Y2118*	probably null	Het
Gm3248	A	T	14: 5,945,781		probably null	Het
Gm5460	T	G	14: 34,043,922	D165E	possibly damaging	Het
Grk4	A	T	5: 34,751,618	N490Y	probably benign	Het
Iglc2	T	A	16: 19,195,136	K59*	probably null	Het
Iqsec3	T	A	6: 121,386,610	H895L	possibly damaging	Het
Itgb7	A	G	15: 102,219,254	S410P	probably damaging	Het
Kmt2d	C	A	15: 98,856,384	V1613F	unknown	Het
Lama1	T	C	17: 67,717,261	L118P		Het
Lrrc25	A	T	8: 70,618,180	S204C	possibly damaging	Het
Malrd1	A	G	2: 15,695,199	D619G	unknown	Het
Ms4a6d	G	A	19: 11,590,073	Q155*	probably null	Het
Mup17	G	A	4: 61,594,398	S86F	probably benign	Het
Nbeal2	C	T	9: 110,630,189		probably null	Het
Nfkb1	A	C	3: 135,613,697	V291G	possibly damaging	Het
Nomo1	G	T	7: 46,066,479	V757F	probably benign	Het
Nutm2	T	A	13: 50,470,007	S247T	probably damaging	Het
Olfr1225	C	T	2: 89,170,361	V284I	probably benign	Het
Olfr1291-ps1	G	T	2: 111,499,896	A215S	probably damaging	Het
Olfr521	C	A	7: 99,767,346	H61Q	probably damaging	Het
Olfr826	T	A	10: 130,180,254	I209F	probably damaging	Het
Olfr834	T	A	9: 18,988,710	C241S	probably damaging	Het
Pcdhb14	A	G	18: 37,448,908	I356V	probably benign	Het
Pnkp	T	A	7: 44,858,678	S142T	probably damaging	Het
Ppia	T	C	11: 6,419,218	S99P	possibly damaging	Het
Prss47	C	T	13: 65,044,993	V325I	probably benign	Het
Ptk7	T	C	17: 46,591,757	D34G	probably damaging	Het
Pwp2	C	T	10: 78,182,480	G126R	probably damaging	Het
Rasa3	G	T	8: 13,595,353	D195E	probably benign	Het
Rnf150	T	A	8: 82,990,471	Y202*	probably null	Het
Sh2d1b2	T	C	1: 170,248,147	V50A	probably damaging	Het
Slc30a4	C	T	2: 122,685,304	V390I	possibly damaging	Het
Slc30a9	G	T	5: 67,352,766		probably null	Het
Slc8a3	T	A	12: 81,214,058		probably null	Het
Smpd3	G	A	8: 106,265,010	R304W	probably damaging	Het
Snta1	A	G	2: 154,376,860	S490P	probably damaging	Het
Srcap	T	G	7: 127,534,828	M887R	probably damaging	Het
St3gal1	A	G	15: 67,111,346	V187A	possibly damaging	Het
Sult2a3	T	C	7: 14,111,524	T137A	probably benign	Het
Uroc1	C	T	6: 90,345,333	R280C	probably damaging	Het
Ush2a	T	C	1: 188,911,416	I4325T	possibly damaging	Het
Vmn1r32	A	G	6: 66,553,189	I201T	probably benign	Het
Zadh2	C	T	18: 84,088,190	A9V	probably benign	Het
Zfp651	T	A	9: 121,767,345	M626K	probably damaging	Het

Other mutations in Tspoap1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00502:Tspoap1	APN	11	87777821	splice site	probably null
IGL01718:Tspoap1	APN	11	87780255	missense	possibly damaging	0.90
IGL02427:Tspoap1	APN	11	87762515	missense	probably benign	0.00
IGL02487:Tspoap1	APN	11	87762516	missense	possibly damaging	0.90
IGL02730:Tspoap1	APN	11	87781709	missense	probably damaging	0.98
IGL02979:Tspoap1	APN	11	87770521	missense	probably damaging	1.00
R0384:Tspoap1	UTSW	11	87766454	missense	probably damaging	1.00
R0396:Tspoap1	UTSW	11	87776346	splice site	probably benign
R0470:Tspoap1	UTSW	11	87776162	missense	probably damaging	0.99
R0637:Tspoap1	UTSW	11	87777240	splice site	probably benign
R0671:Tspoap1	UTSW	11	87762809	missense	probably damaging	1.00
R0960:Tspoap1	UTSW	11	87770595	splice site	probably benign
R0989:Tspoap1	UTSW	11	87765823	missense	probably damaging	0.99
R1396:Tspoap1	UTSW	11	87766120	missense	probably damaging	1.00
R1792:Tspoap1	UTSW	11	87765881	splice site	probably null
R2901:Tspoap1	UTSW	11	87777975	missense	probably benign	0.00
R2902:Tspoap1	UTSW	11	87777975	missense	probably benign	0.00
R3969:Tspoap1	UTSW	11	87762446	missense	probably damaging	1.00
R4400:Tspoap1	UTSW	11	87775603	missense	probably damaging	1.00
R4599:Tspoap1	UTSW	11	87779521	missense	probably damaging	1.00
R4635:Tspoap1	UTSW	11	87777857	missense	probably benign	0.25
R4731:Tspoap1	UTSW	11	87765647	missense	probably benign	0.09
R4755:Tspoap1	UTSW	11	87771663	missense	possibly damaging	0.77
R4780:Tspoap1	UTSW	11	87778443	missense	possibly damaging	0.48
R4960:Tspoap1	UTSW	11	87766396	nonsense	probably null
R5494:Tspoap1	UTSW	11	87775205	missense	possibly damaging	0.47
R5687:Tspoap1	UTSW	11	87777126	missense	probably damaging	1.00
R6200:Tspoap1	UTSW	11	87761703	missense	possibly damaging	0.85
R6563:Tspoap1	UTSW	11	87777159	missense	possibly damaging	0.87
R6816:Tspoap1	UTSW	11	87765665	missense	probably benign
R6897:Tspoap1	UTSW	11	87765812	missense	probably damaging	1.00
R7141:Tspoap1	UTSW	11	87774697	missense	probably damaging	1.00
R7215:Tspoap1	UTSW	11	87770489	missense	probably benign	0.02
R7341:Tspoap1	UTSW	11	87766379	missense	probably damaging	1.00
R7360:Tspoap1	UTSW	11	87778521	missense	probably benign	0.09
R7483:Tspoap1	UTSW	11	87761525	missense	probably benign	0.00
R7617:Tspoap1	UTSW	11	87763625	missense	probably benign	0.02
R7793:Tspoap1	UTSW	11	87764310	missense	probably benign	0.00
R7814:Tspoap1	UTSW	11	87775524	missense	probably damaging	1.00
R8371:Tspoap1	UTSW	11	87778301	missense	probably benign	0.01
R8768:Tspoap1	UTSW	11	87778371	missense	probably benign	0.03
R8987:Tspoap1	UTSW	11	87763568	missense	probably damaging	1.00
R9004:Tspoap1	UTSW	11	87779458	missense
R9259:Tspoap1	UTSW	11	87779524	missense
R9339:Tspoap1	UTSW	11	87778013	missense	probably benign	0.01
R9424:Tspoap1	UTSW	11	87761256	start gained	probably benign
R9439:Tspoap1	UTSW	11	87774709	missense	probably damaging	0.98
R9455:Tspoap1	UTSW	11	87770533	missense	probably damaging	1.00
Z1176:Tspoap1	UTSW	11	87776057	missense	possibly damaging	0.51

Predicted Primers

PCR Primer
(F):5'- TGGTAAGTTCCTGTCACCCAG -3'
(R):5'- GGACAGTTCCCTTCAAATTCCAC -3'

Sequencing Primer
(F):5'- GTCACCCAGGATCCAGCTTC -3'
(R):5'- CCCCAAAAGGAGACCTTCAGG -3'

Posted On

2019-09-13