Incidental Mutation 'R7394:Fam217a'
ID573682
Institutional Source Beutler Lab
Gene Symbol Fam217a
Ensembl Gene ENSMUSG00000021414
Gene Namefamily with sequence similarity 217, member A
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.136) question?
Stock #R7394 (G1)
Quality Score225.009
Status Validated
Chromosome13
Chromosomal Location34909960-34924310 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 34910279 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Lysine at position 499 (I499K)
Ref Sequence ENSEMBL: ENSMUSP00000021851 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021851] [ENSMUST00000077853] [ENSMUST00000223834] [ENSMUST00000225242]
Predicted Effect possibly damaging
Transcript: ENSMUST00000021851
AA Change: I499K

PolyPhen 2 Score 0.734 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000021851
Gene: ENSMUSG00000021414
AA Change: I499K

DomainStartEndE-ValueType
low complexity region 5 19 N/A INTRINSIC
Pfam:FAM217 206 411 2e-54 PFAM
low complexity region 425 436 N/A INTRINSIC
low complexity region 444 455 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000077853
SMART Domains Protein: ENSMUSP00000077019
Gene: ENSMUSG00000021413

DomainStartEndE-ValueType
low complexity region 40 62 N/A INTRINSIC
low complexity region 68 80 N/A INTRINSIC
coiled coil region 102 123 N/A INTRINSIC
low complexity region 142 150 N/A INTRINSIC
low complexity region 156 170 N/A INTRINSIC
low complexity region 178 197 N/A INTRINSIC
low complexity region 210 233 N/A INTRINSIC
low complexity region 238 249 N/A INTRINSIC
low complexity region 284 294 N/A INTRINSIC
low complexity region 299 324 N/A INTRINSIC
low complexity region 340 360 N/A INTRINSIC
low complexity region 390 417 N/A INTRINSIC
low complexity region 435 497 N/A INTRINSIC
low complexity region 521 535 N/A INTRINSIC
low complexity region 562 581 N/A INTRINSIC
S_TKc 687 1003 4.99e-74 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000220965
Predicted Effect possibly damaging
Transcript: ENSMUST00000223834
AA Change: I651K

PolyPhen 2 Score 0.682 (Sensitivity: 0.86; Specificity: 0.92)
Predicted Effect possibly damaging
Transcript: ENSMUST00000225242
AA Change: I408K

PolyPhen 2 Score 0.761 (Sensitivity: 0.85; Specificity: 0.92)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 99% (66/67)
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700017N19Rik A G 10: 100,609,176 I208V probably benign Het
Abcb11 C T 2: 69,299,867 D282N probably damaging Het
Aldh1l2 T A 10: 83,502,457 I646F probably damaging Het
Alms1 C T 6: 85,622,223 P1344S possibly damaging Het
Ank2 T A 3: 126,936,653 I711L possibly damaging Het
Ankrd6 T C 4: 32,821,298 N251D probably damaging Het
Ap3m1 T C 14: 21,038,079 T304A probably benign Het
Arhgef39 T C 4: 43,499,532 T26A possibly damaging Het
C530008M17Rik GCGCGAGGCCGAGAGGCAGGAGGAGGAAGCAAGACAACGCGAGGCCGAGAGGCAGG GCGCGAGGCCGAGAGGCAGG 5: 76,856,954 probably benign Het
Carnmt1 G T 19: 18,670,837 probably benign Het
Ccr4 C T 9: 114,491,926 R357H probably benign Het
Cd4 T A 6: 124,873,041 M104L probably benign Het
Cd74 A T 18: 60,803,893 probably benign Het
Cdcp1 T C 9: 123,173,813 Y731C probably damaging Het
Cdyl2 A G 8: 116,624,051 S114P not run Het
Cenpv T C 11: 62,536,288 D148G probably damaging Het
Cep89 G A 7: 35,429,928 R630H probably damaging Het
Cfap57 T A 4: 118,593,137 Y596F probably benign Het
Clec4a2 C A 6: 123,139,120 A122E unknown Het
Col4a2 A G 8: 11,446,184 T1602A probably benign Het
Cyp2j11 A T 4: 96,316,440 Y290N probably benign Het
Dhx38 A T 8: 109,556,523 V554E probably damaging Het
Ebf2 T C 14: 67,237,526 V70A probably damaging Het
Enpp5 G A 17: 44,085,264 G356S probably damaging Het
Fras1 C A 5: 96,712,450 Y2118* probably null Het
Gm3248 A T 14: 5,945,781 probably null Het
Gm5460 T G 14: 34,043,922 D165E possibly damaging Het
Grk4 A T 5: 34,751,618 N490Y probably benign Het
Iglc2 T A 16: 19,195,136 K59* probably null Het
Iqsec3 T A 6: 121,386,610 H895L possibly damaging Het
Itgb7 A G 15: 102,219,254 S410P probably damaging Het
Kmt2d C A 15: 98,856,384 V1613F unknown Het
Lama1 T C 17: 67,717,261 L118P Het
Lrrc25 A T 8: 70,618,180 S204C possibly damaging Het
Malrd1 A G 2: 15,695,199 D619G unknown Het
Ms4a6d G A 19: 11,590,073 Q155* probably null Het
Mup17 G A 4: 61,594,398 S86F probably benign Het
Nbeal2 C T 9: 110,630,189 probably null Het
Nfkb1 A C 3: 135,613,697 V291G possibly damaging Het
Nomo1 G T 7: 46,066,479 V757F probably benign Het
Nutm2 T A 13: 50,470,007 S247T probably damaging Het
Olfr1225 C T 2: 89,170,361 V284I probably benign Het
Olfr1291-ps1 G T 2: 111,499,896 A215S probably damaging Het
Olfr521 C A 7: 99,767,346 H61Q probably damaging Het
Olfr826 T A 10: 130,180,254 I209F probably damaging Het
Olfr834 T A 9: 18,988,710 C241S probably damaging Het
Pcdhb14 A G 18: 37,448,908 I356V probably benign Het
Pnkp T A 7: 44,858,678 S142T probably damaging Het
Ppia T C 11: 6,419,218 S99P possibly damaging Het
Prss47 C T 13: 65,044,993 V325I probably benign Het
Ptk7 T C 17: 46,591,757 D34G probably damaging Het
Pwp2 C T 10: 78,182,480 G126R probably damaging Het
Rasa3 G T 8: 13,595,353 D195E probably benign Het
Rnf150 T A 8: 82,990,471 Y202* probably null Het
Sh2d1b2 T C 1: 170,248,147 V50A probably damaging Het
Slc30a4 C T 2: 122,685,304 V390I possibly damaging Het
Slc30a9 G T 5: 67,352,766 probably null Het
Slc8a3 T A 12: 81,214,058 probably null Het
Smpd3 G A 8: 106,265,010 R304W probably damaging Het
Snta1 A G 2: 154,376,860 S490P probably damaging Het
Srcap T G 7: 127,534,828 M887R probably damaging Het
St3gal1 A G 15: 67,111,346 V187A possibly damaging Het
Sult2a3 T C 7: 14,111,524 T137A probably benign Het
Tspoap1 C T 11: 87,766,119 Q367* probably null Het
Uroc1 C T 6: 90,345,333 R280C probably damaging Het
Ush2a T C 1: 188,911,416 I4325T possibly damaging Het
Vmn1r32 A G 6: 66,553,189 I201T probably benign Het
Zadh2 C T 18: 84,088,190 A9V probably benign Het
Zfp651 T A 9: 121,767,345 M626K probably damaging Het
Other mutations in Fam217a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01386:Fam217a APN 13 34915649 splice site probably benign
IGL02222:Fam217a APN 13 34911119 missense probably damaging 1.00
IGL02302:Fam217a APN 13 34911161 missense probably damaging 1.00
IGL02371:Fam217a APN 13 34911401 missense possibly damaging 0.53
IGL02538:Fam217a APN 13 34911113 missense probably damaging 0.98
R0324:Fam217a UTSW 13 34910961 missense possibly damaging 0.71
R0616:Fam217a UTSW 13 34913683 missense probably benign 0.03
R1497:Fam217a UTSW 13 34911212 missense probably damaging 0.97
R1934:Fam217a UTSW 13 34910881 missense probably damaging 1.00
R1981:Fam217a UTSW 13 34916754 missense probably benign 0.07
R2133:Fam217a UTSW 13 34913680 missense probably damaging 1.00
R2344:Fam217a UTSW 13 34910335 missense probably damaging 1.00
R4182:Fam217a UTSW 13 34910256 missense possibly damaging 0.75
R4601:Fam217a UTSW 13 34911302 missense probably damaging 1.00
R4909:Fam217a UTSW 13 34910406 missense probably damaging 1.00
R5583:Fam217a UTSW 13 34910297 missense probably damaging 1.00
R6027:Fam217a UTSW 13 34910994 missense possibly damaging 0.77
R6496:Fam217a UTSW 13 34910802 nonsense probably null
R7166:Fam217a UTSW 13 34910315 missense probably benign 0.07
R7710:Fam217a UTSW 13 34911128 missense possibly damaging 0.92
R8409:Fam217a UTSW 13 34916898 missense probably benign
R8716:Fam217a UTSW 13 34924265 start gained probably benign
R8782:Fam217a UTSW 13 34911050 missense probably benign
Predicted Primers PCR Primer
(F):5'- TCAGCAGTGACATTCATGAGTTC -3'
(R):5'- GTTTAAACCCTTGCCAGGAACC -3'

Sequencing Primer
(F):5'- AGCAGTGACATTCATGAGTTCTACCC -3'
(R):5'- TCAACCAATGGCTAGAGTGGTCTC -3'
Posted On2019-09-13