Incidental Mutation 'R7394:Nutm2'
ID573683
Institutional Source Beutler Lab
Gene Symbol Nutm2
Ensembl Gene ENSMUSG00000071909
Gene NameNUT family member 2
SynonymsLOC328250, Gm806
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7394 (G1)
Quality Score225.009
Status Validated
Chromosome13
Chromosomal Location50467307-50475355 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 50470007 bp
ZygosityHeterozygous
Amino Acid Change Serine to Threonine at position 247 (S247T)
Ref Sequence ENSEMBL: ENSMUSP00000094390 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000096633]
Predicted Effect probably damaging
Transcript: ENSMUST00000096633
AA Change: S247T

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000094390
Gene: ENSMUSG00000071909
AA Change: S247T

DomainStartEndE-ValueType
Pfam:NUT 27 733 9e-277 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 99% (66/67)
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700017N19Rik A G 10: 100,609,176 I208V probably benign Het
Abcb11 C T 2: 69,299,867 D282N probably damaging Het
Aldh1l2 T A 10: 83,502,457 I646F probably damaging Het
Alms1 C T 6: 85,622,223 P1344S possibly damaging Het
Ank2 T A 3: 126,936,653 I711L possibly damaging Het
Ankrd6 T C 4: 32,821,298 N251D probably damaging Het
Ap3m1 T C 14: 21,038,079 T304A probably benign Het
Arhgef39 T C 4: 43,499,532 T26A possibly damaging Het
C530008M17Rik GCGCGAGGCCGAGAGGCAGGAGGAGGAAGCAAGACAACGCGAGGCCGAGAGGCAGG GCGCGAGGCCGAGAGGCAGG 5: 76,856,954 probably benign Het
Carnmt1 G T 19: 18,670,837 probably benign Het
Ccr4 C T 9: 114,491,926 R357H probably benign Het
Cd4 T A 6: 124,873,041 M104L probably benign Het
Cd74 A T 18: 60,803,893 probably benign Het
Cdcp1 T C 9: 123,173,813 Y731C probably damaging Het
Cdyl2 A G 8: 116,624,051 S114P not run Het
Cenpv T C 11: 62,536,288 D148G probably damaging Het
Cep89 G A 7: 35,429,928 R630H probably damaging Het
Cfap57 T A 4: 118,593,137 Y596F probably benign Het
Clec4a2 C A 6: 123,139,120 A122E unknown Het
Col4a2 A G 8: 11,446,184 T1602A probably benign Het
Cyp2j11 A T 4: 96,316,440 Y290N probably benign Het
Dhx38 A T 8: 109,556,523 V554E probably damaging Het
Ebf2 T C 14: 67,237,526 V70A probably damaging Het
Enpp5 G A 17: 44,085,264 G356S probably damaging Het
Fam217a A T 13: 34,910,279 I499K possibly damaging Het
Fras1 C A 5: 96,712,450 Y2118* probably null Het
Gm3248 A T 14: 5,945,781 probably null Het
Gm5460 T G 14: 34,043,922 D165E possibly damaging Het
Grk4 A T 5: 34,751,618 N490Y probably benign Het
Iglc2 T A 16: 19,195,136 K59* probably null Het
Iqsec3 T A 6: 121,386,610 H895L possibly damaging Het
Itgb7 A G 15: 102,219,254 S410P probably damaging Het
Kmt2d C A 15: 98,856,384 V1613F unknown Het
Lama1 T C 17: 67,717,261 L118P Het
Lrrc25 A T 8: 70,618,180 S204C possibly damaging Het
Malrd1 A G 2: 15,695,199 D619G unknown Het
Ms4a6d G A 19: 11,590,073 Q155* probably null Het
Mup17 G A 4: 61,594,398 S86F probably benign Het
Nbeal2 C T 9: 110,630,189 probably null Het
Nfkb1 A C 3: 135,613,697 V291G possibly damaging Het
Nomo1 G T 7: 46,066,479 V757F probably benign Het
Olfr1225 C T 2: 89,170,361 V284I probably benign Het
Olfr1291-ps1 G T 2: 111,499,896 A215S probably damaging Het
Olfr521 C A 7: 99,767,346 H61Q probably damaging Het
Olfr826 T A 10: 130,180,254 I209F probably damaging Het
Olfr834 T A 9: 18,988,710 C241S probably damaging Het
Pcdhb14 A G 18: 37,448,908 I356V probably benign Het
Pnkp T A 7: 44,858,678 S142T probably damaging Het
Ppia T C 11: 6,419,218 S99P possibly damaging Het
Prss47 C T 13: 65,044,993 V325I probably benign Het
Ptk7 T C 17: 46,591,757 D34G probably damaging Het
Pwp2 C T 10: 78,182,480 G126R probably damaging Het
Rasa3 G T 8: 13,595,353 D195E probably benign Het
Rnf150 T A 8: 82,990,471 Y202* probably null Het
Sh2d1b2 T C 1: 170,248,147 V50A probably damaging Het
Slc30a4 C T 2: 122,685,304 V390I possibly damaging Het
Slc30a9 G T 5: 67,352,766 probably null Het
Slc8a3 T A 12: 81,214,058 probably null Het
Smpd3 G A 8: 106,265,010 R304W probably damaging Het
Snta1 A G 2: 154,376,860 S490P probably damaging Het
Srcap T G 7: 127,534,828 M887R probably damaging Het
St3gal1 A G 15: 67,111,346 V187A possibly damaging Het
Sult2a3 T C 7: 14,111,524 T137A probably benign Het
Tspoap1 C T 11: 87,766,119 Q367* probably null Het
Uroc1 C T 6: 90,345,333 R280C probably damaging Het
Ush2a T C 1: 188,911,416 I4325T possibly damaging Het
Vmn1r32 A G 6: 66,553,189 I201T probably benign Het
Zadh2 C T 18: 84,088,190 A9V probably benign Het
Zfp651 T A 9: 121,767,345 M626K probably damaging Het
Other mutations in Nutm2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00885:Nutm2 APN 13 50474860 missense probably benign 0.18
IGL01087:Nutm2 APN 13 50469629 missense probably damaging 1.00
IGL01707:Nutm2 APN 13 50469717 missense probably damaging 0.96
IGL02085:Nutm2 APN 13 50473793 splice site probably null
IGL02238:Nutm2 APN 13 50471039 missense probably damaging 1.00
IGL02369:Nutm2 APN 13 50469908 missense probably benign 0.16
IGL02429:Nutm2 APN 13 50469480 missense probably benign 0.44
IGL03083:Nutm2 APN 13 50467444 missense probably damaging 0.98
R0233:Nutm2 UTSW 13 50467405 missense probably benign 0.41
R0233:Nutm2 UTSW 13 50467405 missense probably benign 0.41
R0321:Nutm2 UTSW 13 50472955 missense probably damaging 0.98
R1481:Nutm2 UTSW 13 50469481 missense probably damaging 0.99
R1605:Nutm2 UTSW 13 50469919 missense possibly damaging 0.68
R1679:Nutm2 UTSW 13 50469386 missense probably benign 0.17
R1744:Nutm2 UTSW 13 50469354 missense probably benign 0.03
R1768:Nutm2 UTSW 13 50473116 missense probably damaging 1.00
R1969:Nutm2 UTSW 13 50473842 missense probably damaging 1.00
R2026:Nutm2 UTSW 13 50474820 missense probably benign 0.00
R2187:Nutm2 UTSW 13 50467417 missense probably benign 0.00
R3912:Nutm2 UTSW 13 50472940 missense possibly damaging 0.92
R4025:Nutm2 UTSW 13 50469353 missense probably benign
R4367:Nutm2 UTSW 13 50469884 missense probably benign 0.01
R4668:Nutm2 UTSW 13 50472997 missense probably benign 0.18
R4940:Nutm2 UTSW 13 50474873 missense possibly damaging 0.58
R4987:Nutm2 UTSW 13 50472343 missense possibly damaging 0.93
R4988:Nutm2 UTSW 13 50472343 missense possibly damaging 0.93
R5821:Nutm2 UTSW 13 50469855 missense probably benign 0.01
R5986:Nutm2 UTSW 13 50474460 missense probably damaging 1.00
R6189:Nutm2 UTSW 13 50469738 missense possibly damaging 0.91
R7101:Nutm2 UTSW 13 50472898 missense probably benign 0.00
R7192:Nutm2 UTSW 13 50473069 missense probably damaging 1.00
R7591:Nutm2 UTSW 13 50473867 missense probably damaging 0.98
R8217:Nutm2 UTSW 13 50469723 missense probably benign 0.16
R8347:Nutm2 UTSW 13 50472337 missense probably benign 0.05
R8811:Nutm2 UTSW 13 50469953 missense probably benign 0.02
X0028:Nutm2 UTSW 13 50472954 missense probably benign 0.04
Predicted Primers PCR Primer
(F):5'- CAAGTTGTCCAGCTGGTTCC -3'
(R):5'- GACTATGTCCAAACCCTAGCTC -3'

Sequencing Primer
(F):5'- GTCTCCAGTGAACTCTGCACAG -3'
(R):5'- TCCCAGGACTTCAGGATCTCAG -3'
Posted On2019-09-13