Incidental Mutation 'R7394:St3gal1'
ID573689
Institutional Source Beutler Lab
Gene Symbol St3gal1
Ensembl Gene ENSMUSG00000013846
Gene NameST3 beta-galactoside alpha-2,3-sialyltransferase 1
SynonymsSiat4a, CMP-N-acetylneuraminate: [beta-galactosidase alpha-2,3] sialytransferase, ST3GalI, Siat4
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.156) question?
Stock #R7394 (G1)
Quality Score225.009
Status Validated
Chromosome15
Chromosomal Location67102875-67176830 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 67111346 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 187 (V187A)
Ref Sequence ENSEMBL: ENSMUSP00000155359 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000092640] [ENSMUST00000229028] [ENSMUST00000229213]
Predicted Effect possibly damaging
Transcript: ENSMUST00000092640
AA Change: V187A

PolyPhen 2 Score 0.524 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000090307
Gene: ENSMUSG00000013846
AA Change: V187A

DomainStartEndE-ValueType
transmembrane domain 12 34 N/A INTRINSIC
Pfam:Glyco_transf_29 80 336 1.7e-74 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000229028
AA Change: V187A

PolyPhen 2 Score 0.524 (Sensitivity: 0.88; Specificity: 0.90)
Predicted Effect possibly damaging
Transcript: ENSMUST00000229213
AA Change: V187A

PolyPhen 2 Score 0.524 (Sensitivity: 0.88; Specificity: 0.90)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000229742
Predicted Effect noncoding transcript
Transcript: ENSMUST00000230150
Meta Mutation Damage Score 0.4530 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 99% (66/67)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a type II membrane protein that catalyzes the transfer of sialic acid from CMP-sialic acid to galactose-containing substrates. The encoded protein is normally found in the Golgi but can be proteolytically processed to a soluble form. Correct glycosylation of the encoded protein may be critical to its sialyltransferase activity. This protein, which is a member of glycosyltransferase family 29, can use the same acceptor substrates as does sialyltransferase 4B. Two transcript variants encoding the same protein have been found for this gene. Other transcript variants may exist, but have not been fully characterized yet. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutation of this gene results in altered terminal glycosylation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700017N19Rik A G 10: 100,609,176 I208V probably benign Het
Abcb11 C T 2: 69,299,867 D282N probably damaging Het
Aldh1l2 T A 10: 83,502,457 I646F probably damaging Het
Alms1 C T 6: 85,622,223 P1344S possibly damaging Het
Ank2 T A 3: 126,936,653 I711L possibly damaging Het
Ankrd6 T C 4: 32,821,298 N251D probably damaging Het
Ap3m1 T C 14: 21,038,079 T304A probably benign Het
Arhgef39 T C 4: 43,499,532 T26A possibly damaging Het
C530008M17Rik GCGCGAGGCCGAGAGGCAGGAGGAGGAAGCAAGACAACGCGAGGCCGAGAGGCAGG GCGCGAGGCCGAGAGGCAGG 5: 76,856,954 probably benign Het
Carnmt1 G T 19: 18,670,837 probably benign Het
Ccr4 C T 9: 114,491,926 R357H probably benign Het
Cd4 T A 6: 124,873,041 M104L probably benign Het
Cd74 A T 18: 60,803,893 probably benign Het
Cdcp1 T C 9: 123,173,813 Y731C probably damaging Het
Cdyl2 A G 8: 116,624,051 S114P not run Het
Cenpv T C 11: 62,536,288 D148G probably damaging Het
Cep89 G A 7: 35,429,928 R630H probably damaging Het
Cfap57 T A 4: 118,593,137 Y596F probably benign Het
Clec4a2 C A 6: 123,139,120 A122E unknown Het
Col4a2 A G 8: 11,446,184 T1602A probably benign Het
Cyp2j11 A T 4: 96,316,440 Y290N probably benign Het
Dhx38 A T 8: 109,556,523 V554E probably damaging Het
Ebf2 T C 14: 67,237,526 V70A probably damaging Het
Enpp5 G A 17: 44,085,264 G356S probably damaging Het
Fam217a A T 13: 34,910,279 I499K possibly damaging Het
Fras1 C A 5: 96,712,450 Y2118* probably null Het
Gm3248 A T 14: 5,945,781 probably null Het
Gm5460 T G 14: 34,043,922 D165E possibly damaging Het
Grk4 A T 5: 34,751,618 N490Y probably benign Het
Iglc2 T A 16: 19,195,136 K59* probably null Het
Iqsec3 T A 6: 121,386,610 H895L possibly damaging Het
Itgb7 A G 15: 102,219,254 S410P probably damaging Het
Kmt2d C A 15: 98,856,384 V1613F unknown Het
Lama1 T C 17: 67,717,261 L118P Het
Lrrc25 A T 8: 70,618,180 S204C possibly damaging Het
Malrd1 A G 2: 15,695,199 D619G unknown Het
Ms4a6d G A 19: 11,590,073 Q155* probably null Het
Mup17 G A 4: 61,594,398 S86F probably benign Het
Nbeal2 C T 9: 110,630,189 probably null Het
Nfkb1 A C 3: 135,613,697 V291G possibly damaging Het
Nomo1 G T 7: 46,066,479 V757F probably benign Het
Nutm2 T A 13: 50,470,007 S247T probably damaging Het
Olfr1225 C T 2: 89,170,361 V284I probably benign Het
Olfr1291-ps1 G T 2: 111,499,896 A215S probably damaging Het
Olfr521 C A 7: 99,767,346 H61Q probably damaging Het
Olfr826 T A 10: 130,180,254 I209F probably damaging Het
Olfr834 T A 9: 18,988,710 C241S probably damaging Het
Pcdhb14 A G 18: 37,448,908 I356V probably benign Het
Pnkp T A 7: 44,858,678 S142T probably damaging Het
Ppia T C 11: 6,419,218 S99P possibly damaging Het
Prss47 C T 13: 65,044,993 V325I probably benign Het
Ptk7 T C 17: 46,591,757 D34G probably damaging Het
Pwp2 C T 10: 78,182,480 G126R probably damaging Het
Rasa3 G T 8: 13,595,353 D195E probably benign Het
Rnf150 T A 8: 82,990,471 Y202* probably null Het
Sh2d1b2 T C 1: 170,248,147 V50A probably damaging Het
Slc30a4 C T 2: 122,685,304 V390I possibly damaging Het
Slc30a9 G T 5: 67,352,766 probably null Het
Slc8a3 T A 12: 81,214,058 probably null Het
Smpd3 G A 8: 106,265,010 R304W probably damaging Het
Snta1 A G 2: 154,376,860 S490P probably damaging Het
Srcap T G 7: 127,534,828 M887R probably damaging Het
Sult2a3 T C 7: 14,111,524 T137A probably benign Het
Tspoap1 C T 11: 87,766,119 Q367* probably null Het
Uroc1 C T 6: 90,345,333 R280C probably damaging Het
Ush2a T C 1: 188,911,416 I4325T possibly damaging Het
Vmn1r32 A G 6: 66,553,189 I201T probably benign Het
Zadh2 C T 18: 84,088,190 A9V probably benign Het
Zfp651 T A 9: 121,767,345 M626K probably damaging Het
Other mutations in St3gal1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01528:St3gal1 APN 15 67112617 missense probably benign 0.03
Benelux UTSW 15 67113785 nonsense probably null
Luxembourg UTSW 15 67111346 missense possibly damaging 0.52
Monaco UTSW 15 67113662 missense probably damaging 0.99
Strasbourg UTSW 15 67106673 missense probably damaging 0.99
R0452:St3gal1 UTSW 15 67109655 splice site probably benign
R0478:St3gal1 UTSW 15 67113730 missense probably damaging 1.00
R0735:St3gal1 UTSW 15 67113687 missense probably benign
R2357:St3gal1 UTSW 15 67113782 missense probably benign 0.01
R5061:St3gal1 UTSW 15 67108229 missense probably benign 0.40
R5199:St3gal1 UTSW 15 67113715 missense probably benign 0.00
R5734:St3gal1 UTSW 15 67106673 missense probably damaging 0.99
R5828:St3gal1 UTSW 15 67113785 nonsense probably null
R6370:St3gal1 UTSW 15 67111346 missense possibly damaging 0.52
R6371:St3gal1 UTSW 15 67111346 missense possibly damaging 0.52
R6373:St3gal1 UTSW 15 67111346 missense possibly damaging 0.52
R6385:St3gal1 UTSW 15 67111346 missense possibly damaging 0.52
R6387:St3gal1 UTSW 15 67111346 missense possibly damaging 0.52
R6388:St3gal1 UTSW 15 67111346 missense possibly damaging 0.52
R6417:St3gal1 UTSW 15 67111346 missense possibly damaging 0.52
R6420:St3gal1 UTSW 15 67111346 missense possibly damaging 0.52
R6421:St3gal1 UTSW 15 67111346 missense possibly damaging 0.52
R6462:St3gal1 UTSW 15 67111346 missense possibly damaging 0.52
R6463:St3gal1 UTSW 15 67111346 missense possibly damaging 0.52
R6469:St3gal1 UTSW 15 67111346 missense possibly damaging 0.52
R6473:St3gal1 UTSW 15 67111346 missense possibly damaging 0.52
R6474:St3gal1 UTSW 15 67111346 missense possibly damaging 0.52
R6759:St3gal1 UTSW 15 67111346 missense possibly damaging 0.52
R6760:St3gal1 UTSW 15 67111346 missense possibly damaging 0.52
R6894:St3gal1 UTSW 15 67111346 missense possibly damaging 0.52
R6963:St3gal1 UTSW 15 67111346 missense possibly damaging 0.52
R7250:St3gal1 UTSW 15 67106729 missense possibly damaging 0.89
R7588:St3gal1 UTSW 15 67111346 missense possibly damaging 0.52
R7590:St3gal1 UTSW 15 67111346 missense possibly damaging 0.52
R7591:St3gal1 UTSW 15 67111346 missense possibly damaging 0.52
R7860:St3gal1 UTSW 15 67111265 missense probably benign 0.38
R7954:St3gal1 UTSW 15 67112573 missense probably damaging 1.00
R8346:St3gal1 UTSW 15 67113662 missense probably damaging 0.99
R8347:St3gal1 UTSW 15 67113662 missense probably damaging 0.99
R8348:St3gal1 UTSW 15 67113662 missense probably damaging 0.99
Z1177:St3gal1 UTSW 15 67111367 missense possibly damaging 0.82
Predicted Primers PCR Primer
(F):5'- AGAGGAACCTTACGGAACAGCC -3'
(R):5'- GTCTGGCCTATGTCTACAAGG -3'

Sequencing Primer
(F):5'- CCCAGCAGGAGTGATACGTTG -3'
(R):5'- AGGTTCCCATTGTACACACGGAG -3'
Posted On2019-09-13